Previous Contig 008030:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS057G02Sequence622008030 (6)gb:BT004643_16376774e-65Arabidopsis thaliana At3g55410 gene, complete cds.
JMFS111D03Sequence638008030 (6)gb:BT004643_16376777e-69Arabidopsis thaliana At3g55410 gene, complete cds.
JMFS122D11Sequence561008030 (6)gb:BT004643_16376779e-66Arabidopsis thaliana At3g55410 gene, complete cds.
JMFS143B01Sequence619008030 (6)gb:BT004643_16376771e-65Arabidopsis thaliana At3g55410 gene, complete cds.
JMFS166G09Sequence363008030 (6)gb:BT004643_16376775e-43Arabidopsis thaliana At3g55410 gene, complete cds.
JMSF050P24Sequence532008030 (6)gb:BT004643_16376775e-28Arabidopsis thaliana At3g55410 gene, complete cds.690002290 (3)gb:AB010075_15109886e-64Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPA24.>gb:AY074374_1567

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS122D11+ TCAGGAAT
JMFS143B01+ CAGGAAT
JMFS057G02+ CAGGAAT
                      ____________________________________________________________
consensus TCAGGAAT
 
. : . : . : . : . : . :
JMFS122D11+ CACTCTCTCTTCTAAATCCAAAGGGTCCAACTTGGCTTTCATGTGACCATTGACCTGATA
JMFS143B01+ CACTCTCTCTTCTAAATCCAAAGGGTCCAACTTGGCTTTCATGTGACCATTGACCTGATA
JMFS111D03+ TCTCTCTTCTAAATCCAAAGGGTCCAACTTGGCTTTCATGTGACCATTGACCTGATA
JMFS057G02+ CACTCTCTCTTCTANATCCAAAGGGTCCAACTTGGCTTTCATGTGACCATTGACCTGATA
                      ____________________________________________________________
consensus CACTCTCTCTTCTAAATCCAAAGGGTCCAACTTGGCTTTCATGTGACCATTGACCTGATA
 
. : . : . : . : . : . :
JMFS122D11+ AGCCCTTACAAGCAACAAGAGCCGCATGCTTTCCTGAATTGTTTGGCCAGAGATCCCAGG
JMFS143B01+ AGCCCTTACAAGCAACAAGAGCCGCATGCTTTCCTGAATTGTTTGGCCAGAGATCCCAGG
JMFS111D03+ AGCCCTTACAAGCAACAAGAGCCGCATGCTTTCCTGAATTGTTTGGCCAGAGATCCCAGG
JMFS057G02+ AGCCCTTACAAGCAACAAGAGCCGCATGCTTTCCTGAATTGTTTGGCCAGAGATCCCAGG
                      ____________________________________________________________
consensus AGCCCTTACAAGCAACAAGAGCCGCATGCTTTCCTGAATTGTTTGGCCAGAGATCCCAGG
 
. : . : . : . : . : . :
JMFS122D11+ AGATGTAGTTGCCTGGCCAACAAAATTCCTGAAGAAATTATCCCATGACTCATCAACACT
JMFS143B01+ AGATGTAGTTGCCTGGCCAACAAAATTCCTGAAGAAATTATCCCATGACTCATCAACACT
JMFS111D03+ AGATGTAGTTGCCTGGCCAACAAAATTCCTGAAGAAATTATCCCATGACTCATCAACACT
JMFS166G09+ ATGTAGTTGCCTGGCCAACAAAATTCCTGAAGAAATTATCCCATGACTCATCAACACT
JMFS057G02+ AGATGTAGTTGCCTGGCCAACAAAATTCCTGAAGAAATTATCCCATGACTCATCAACACT
                      ____________________________________________________________
consensus AGATGTAGTTGCCTGGCCAACAAAATTCCTGAAGAAATTATCCCATGACTCATCAACACT
 
. : . : . : . : . : . :
JMFS122D11+ ATTTGGGTCTTGTTCCCATGCCCGCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
JMFS143B01+ ATTTGGGTCTTGTTCCCATGCCCGCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
JMFS111D03+ ATTTGGGTCTTGTTCCCATGCCCGCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
JMFS166G09+ ATTTGGGTCTTGTTCCCATGCCCGCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
JMFS057G02+ ATTTGGGTCTTGTTCCCATGCCCGCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
JMSF050P24+ CTTGTTCCCATGCCCNCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
                      ____________________________________________________________
consensus ATTTGGGTCTTGTTCCCATGCCCGCTGAAGCTCCTCAAGGTACACACTACTTGTCCCATC
 
. : . : . : . : . : . :
JMFS122D11+ TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
JMFS143B01+ TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
JMFS111D03+ TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
JMFS166G09+ TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
JMFS057G02+ TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
JMSF050P24+ TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
                      ____________________________________________________________
consensus TAAGAAACTATCCGTCAGCTTAGAAAGTGGCACAGGCCGTGGCACAGGAGCAGATTGTGC
 
. : . : . : . : . : . :
JMFS122D11+ CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
JMFS143B01+ CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
JMFS111D03+ CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
JMFS166G09+ CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
JMFS057G02+ CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
JMSF050P24+ CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
                      ____________________________________________________________
consensus CTTTGACCGAACAACTGTGGTGTGAAAGTACCGACTTTGAGAAGGGAGAATACGAGTTCC
 
. : . : . : . : . : . :
JMFS122D11+ CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
JMFS143B01+ CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
JMFS111D03+ CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
JMFS166G09+ CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
JMFS057G02+ CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
JMSF050P24+ CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
                      ____________________________________________________________
consensus CGGAACATGTGACCCACCATGTGACAAAGCTCTCCTAAGGGCAAGCTTTGCCACATTAGA
 
. : . : . : . : . : . :
JMFS122D11+ TCCAGCTCTAAACCACACCATTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
JMFS143B01+ TCCAGCTCTAAACCACACCATTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
JMFS111D03+ TCCAGCTCTAAACCACACCATTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
JMFS166G09+ TCCAGCTCTAAACCACACCATTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
JMFS057G02+ TCCAGCTCTAAACCACACCATTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
JMSF050P24+ TCCAGCTCTAAACCACACCANTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
                      ____________________________________________________________
consensus TCCAGCTCTAAACCACACCATTGCTACAACCCGAGTTCTCAAAATTCAATAACTTGTCCA
 
. : . : . : . : . : . :
JMFS122D11+ AAATCTTATGCACTTAACCTCACTAACAGCAGTAGACCATACTCTATCTCTCGTACGGGC
JMFS143B01+ AAATCTTATGCACTTAACCTCACTAACAGCAGTAGACCATACTCTATCTCTCGTACGGGC
JMFS111D03+ AAATCTTATGCACTTAACCTCACTAACAGCAGTAGACCATAC----TCTCTCGTACGGGC
JMFS166G09+ AAATC
JMFS057G02+ AAATCTTATGCACTTAACCTCACTAACAGCAGTAGACCATACTCTATCTCTCGTACGGGC
JMSF050P24+ AAATCTTATGCACTTAACCTCACTAACAGCAGTAGACCATACTCTATCTCTCGTACGGGC
                      ____________________________________________________________
consensus AAATCTTATGCACTTAACCTCACTAACAGCAGTAGACCATACTCTATCTCTCGTACGGGC
 
. : . : . : . : . : . :
JMFS122D11+ AAGAAATGAGAGA
JMFS143B01+ AAGAAATGAGAGAGTTTCGGCTGCTCAGAGGAACCCTAAAATGTGGGCATAACCAAAATA
JMFS111D03+ AAGAAATGAGAGAGTTTCGGCTGCTCAGAGGAACCCTAAAATGTGGGCATAACCAAAATA
JMFS057G02+ AAGAAATGAGAGAGTTTCGGCTGCTCAGAGGAACCCTAAAATGTGGGCATAACCAAAATA
JMSF050P24+ AAGAAATGAGAGAGTTTCGGCTGCTCAGAGGAACCCTAAAATGTGGGCATAACCAAAATA
                      ____________________________________________________________
consensus AAGAAATGAGAGAGTTTCGGCTGCTCAGAGGAACCCTAAAATGTGGGCATAACCAAAATA
 
. : . : . : . : . : . :
JMFS143B01+ GCTTCGAGAGC
JMFS111D03+ GCTTCGAGAGC
JMFS057G02+ GCTTCGAGAGC
JMSF050P24+ GCTTCGAGAGCTCGGTNTATACTTGGAAATGGAAGTTCAAAGTTGAAACGAAGATCTTNT
                      ____________________________________________________________
consensus GCTTCGAGAGCTCGGTNTATACTTGGAAATGGAAGTTCAAAGTTGAAACGAAGATCTTNT
 
. : . : . : . : . : . :
JMSF050P24+ CCTAGTAATATCTTNTACGGACTACTATTTNGGATTGCCACTTGCCTTTTTCTCAAATCC
                      ____________________________________________________________
consensus CCTAGTAATATCTTNTACGGACTACTATTTNGGATTGCCACTTGCCTTTTTCTCAAATCC