Previous Contig 008025:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035N03Sequence638008025 (3)gb:AB010692_15111191e-56Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.711013711 (3)gb:AC134927_17418881e-21Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete seq
JMSF047F13Sequence568008025 (3)gb:AB010692_15111196e-38Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.798013711 (3)gb:AC134927_17418881e-21Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete seq
JMSF050P04Sequence436008025 (3)gb:AB010692_15111191e-12Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18I23.444013711 (3)gb:AC134927_17418885e-10Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035N03+ ATAGTAGTTTGTCAGCAATAATTACCCCTTCATCCCACTCCAGGATAAAAGTCC
                      ____________________________________________________________
consensus ATAGTAGTTTGTCAGCAATAATTACCCCTTCATCCCACTCCAGGATAAAAGTCC
 
. : . : . : . : . : . :
JMSF047F13+ CCATGCTTGTGAGCAGTGNTGGTCCATCAAGGAGGCGGCAGAGTAA
JMSF035N03+ CAAGTACCTTAACGCCATGCTTGTGAGCAGTGTTGGTCCAGCAAGGAGGCGGCAGAGTAA
                      ____________________________________________________________
consensus CAAGTACCTTAACGCCATGCTTGTGAGCAGTGTTGGTCCATCAAGGAGGCGGCAGAGTAA
 
. : . : . : . : . : . :
JMSF047F13+ CCAAATTGTGCGAGAAGTAAACGAACACATCCATCAAATACCAATGCCATATAGCATAAG
JMSF035N03+ CCAAATTGTGCGAGAAGTAAACGAACACATCCATCAAATACCAATGCCATATAGCATAAG
                      ____________________________________________________________
consensus CCAAATTGTGCGAGAAGTAAACGAACACATCCATCAAATACCAATGCCATATAGCATAAG
 
. : . : . : . : . : . :
JMSF047F13+ CATCGGGATTACTACCGCCCTGTATCCACTTATCATCAAGGTACCCTCCCTCCATGTCGC
JMSF035N03+ CATCGGGATTACTACCGCCCTGTATCCACTTATCATCAAGGTACCCTCCCTCCATGTCGT
                      ____________________________________________________________
consensus CATCGGGATTACTACCGCCCTGTATCCACTTATCATCAAGGTACCCTCCCTCCATGTCGT
 
. : . : . : . : . : . :
JMSF047F13+ GACAAACCAGAATCCTCGGCCGCTCCGNCAGCGNGCCGGCGGGAGNTGCGGGGAGCTTGA
JMSF035N03+ GACAAACCAGAATCCTCGGCCGCTCCGGCAGCGGGCCGGCGGGAGCTGCGGGGAGCTTGA
JMSF050P04+ TGCGGGGAGCTTGA
                      ____________________________________________________________
consensus GACAAACCAGAATCCTCGGCCGCTCCGGCAGCGGGCCGGCGGGAGCTGCGGGGAGCTTGA
 
. : . : . : . : . : . :
JMSF047F13+ NGGAGGCCTTGTTGAACGGGAAGTGAAAGGAGTCGAAGTAGGATCTAGACTCGAGCTCTT
JMSF035N03+ CGGAGGCCTTGTTGAACGGGAAGTGAAAGGAGTCGAAGTAGGATCTAGACTCGAGCTCTT
JMSF050P04+ CGGAGGCCTTGTTGAACGGGAAGTGAAAGGAGTCGAAGTAGGATCTAGACTCGAGCTCTT
                      ____________________________________________________________
consensus CGGAGGCCTTGTTGAACGGGAAGTGAAAGGAGTCGAAGTAGGATCTAGACTCGAGCTCTT
 
. : . : . : . : . : . :
JMSF047F13+ CCAGAGTTTTCAGCGGGTAAGAGATCGGAATTGATGGAACTGAAGGATCGAACGGCGGTG
JMSF035N03+ CCAGAGTTTTCAGCGGGTAAGAGATCGGAATTGATGGAACTGAAGGATCGAACGGCGGTG
JMSF050P04+ CCAGAGTTTTCAGCGGGTAAGAGATCGGAATTGATGGAACTGAAGGATCGAACGGCGGTG
                      ____________________________________________________________
consensus CCAGAGTTTTCAGCGGGTAAGAGATCGGAATTGATGGAACTGAAGGATCGAACGGCGGTG
 
. : . : . : . : . : . :
JMSF047F13+ CATCGCCGGAGGANTTGGACTCGGCCATTGGATTGAAAGCAGAGACGAAACGGAGGAGAG
JMSF035N03+ CATCGCCGGAGGAGTTGGACTCGGCCATTGGATTGAAAGCAGAGACGAAACGGAGGAGAG
JMSF050P04+ CATCGCCGGAGGAGTTGGACTCGGCCATTGGATTGAAAGCAGAGACGAAACGGAGGAGAG
                      ____________________________________________________________
consensus CATCGCCGGAGGAGTTGGACTCGGCCATTGGATTGAAAGCAGAGACGAAACGGAGGAGAG
 
. : . : . : . : . : . :
JMSF047F13+ AATCGAGACGAGATTTGAACTTCGCTAGGGTATGGCGGTGGCGGGATTTTACATATGATC
JMSF035N03+ AATCGAGACGAGATTTGAACTTCGCTAGGGTATGGCGGTGGCGGGATTTTACATATGATC
JMSF050P04+ AATCGAGACGAGATTTGAACTTCGCTAGGGTATGGCGGTGGCGGGATTTTACATATGATC
                      ____________________________________________________________
consensus AATCGAGACGAGATTTGAACTTCGCTAGGGTATGGCGGTGGCGGGATTTTACATATGATC
 
. : . : . : . : . : . :
JMSF047F13+ GGAATGGGGATAGCATCGGATAACAAACNCCGGATTTGTAAAGAGCATTGGGTGAGAATC
JMSF035N03+ GGAATGGGGATAGCATCGGATAACAAACGCCGGATTTGTAAAGAGCATTGGGTGAGAATC
JMSF050P04+ NGAATGGGGATAGCATCGGATAACAAACGCCGGATTTGTAAAGAGCATTGGGTGAGAATC
                      ____________________________________________________________
consensus GGAATGGGGATAGCATCGGATAACAAACGCCGGATTTGTAAAGAGCATTGGGTGAGAATC
 
. : . : . : . : . : . :
JMSF047F13+ CATGAACGCAGTTGACCGTTGAAGTGAACGTTGAGATAC
JMSF035N03+ CATGAACGCAGTTGACCGTTGAAGTGAACGTTGAGATAC
JMSF050P04+ CATGAACGCAGTTGACCGTTGAAGTGAACGTTGAGATACAACTGACTTTAGAGTAAACGG
                      ____________________________________________________________
consensus CATGAACGCAGTTGACCGTTGAAGTGAACGTTGAGATACAACTGACTTTAGAGTAAACGG
 
. : . : . : . : . : . :
JMSF050P04+ AAAGGAACTTTTGGATTGGAAATTACTCGTCTCCCGCCATTCATGGCGGTGTTTCCCCCC
                      ____________________________________________________________
consensus AAAGGAACTTTTGGATTGGAAATTACTCGTCTCCCGCCATTCATGGCGGTGTTTCCCCCC