Previous Contig 008014:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF050M15Sequence664008014 (2)gb:AY085057_15701394e-08Arabidopsis thaliana clone 125943 mRNA, complete sequence.770013902 (2)gb:AY085057_15701390.036Arabidopsis thaliana clone 125943 mRNA, complete sequence.
JMSF050O19Sequence638008014 (2)gb:AY085057_15701394e-08Arabidopsis thaliana clone 125943 mRNA, complete sequence.758013902 (2)gb:AY085057_15701390.035Arabidopsis thaliana clone 125943 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050M15+ GTGG
                      ____________________________________________________________
consensus GTGG
 
. : . : . : . : . : . :
JMSF050O19+ TTAGGTACAGAGAGATGTGATCATTAACCTTCTTGTTT
JMSF050M15+ AGGTTGCTTGTGTCCGCCAGTTTTAGGTACAGAGAGATGTGATCATTAACCTTCTTGTTT
                      ____________________________________________________________
consensus AGGTTGCTTGTGTCCGCCAGTTTTAGGTACAGAGAGATGTGATCATTAACCTTCTTGTTT
 
. : . : . : . : . : . :
JMSF050O19+ TTGTTTCCATTTGGGTGGATAACCAACTTCCTGCAAACGCAAATCAAACCAATTCAGACA
JMSF050M15+ TTGTTTCCATTTGGGTGGATAACCAACTTCCTGCAAACGCAAATCAAACCAATTCAGACA
                      ____________________________________________________________
consensus TTGTTTCCATTTGGGTGGATAACCAACTTCCTGCAAACGCAAATCAAACCAATTCAGACA
 
. : . : . : . : . : . :
JMSF050O19+ GTCGGCTGAATAACCACAATGTTATAAGTTTAACTGTCCAGTGTGAGTAGTTATGGGACA
JMSF050M15+ GTCGGCTGAATAACCACAATGTTATAAGTTTAACTGTCCAGTGTGAGTAGTTATGGGACA
                      ____________________________________________________________
consensus GTCGGCTGAATAACCACAATGTTATAAGTTTAACTGTCCAGTGTGAGTAGTTATGGGACA
 
. : . : . : . : . : . :
JMSF050O19+ TTTTGGTTTAACCCGGTCACTTGAACAGTTATGTTGCAACATAAATTAATTTACCTCTTT
JMSF050M15+ TTTTGGTTTAACCCGGTCACTTGAACAGTTATGTTGCAACATAAATTAATTTACCTCTTT
                      ____________________________________________________________
consensus TTTTGGTTTAACCCGGTCACTTGAACAGTTATGTTGCAACATAAATTAATTTACCTCTTT
 
. : . : . : . : . : . :
JMSF050O19+ GCAGTCTGATTAGGGTCATATGGTAAAGTTTATTCAGTGCACACCCTCTAATGTTAACTG
JMSF050M15+ GCAGTCTGATTAGGGTCATATGGTAAAGTTTATTCAGTGCACACCCTCTAATGTTAACTG
                      ____________________________________________________________
consensus GCAGTCTGATTAGGGTCATATGGTAAAGTTTATTCAGTGCACACCCTCTAATGTTAACTG
 
. : . : . : . : . : . :
JMSF050O19+ CAAGTGGCCTATTGGCCTTTTTTGTTTATCAGTTATAAGCAACCTAAACTAGTTTACTTT
JMSF050M15+ CAAGTGGCCTATTGGCCTTTTTTGTTTATCAGTTATAAGCAACCTAAACTAGTTTACTTT
                      ____________________________________________________________
consensus CAAGTGGCCTATTGGCCTTTTTTGTTTATCAGTTATAAGCAACCTAAACTAGTTTACTTT
 
. : . : . : . : . : . :
JMSF050O19+ CTTGTGGTCCAGTTAAGGTCACAAAGAATGATTTATCTGGTGTACACTTTCGGAAAGTTT
JMSF050M15+ CTTGTGGTCCAGTTAAGGTCACAAAGAATGATTTATCTGGTGTACACTTTCGGAAAGTTT
                      ____________________________________________________________
consensus CTTGTGGTCCAGTTAAGGTCACAAAGAATGATTTATCTGGTGTACACTTTCGGAAAGTTT
 
. : . : . : . : . : . :
JMSF050O19+ GATGGTAAGTTAAGTTAGTTAATTACCATTTGTAGCCTCCGACATCAAAAGCATCTGAAA
JMSF050M15+ GATGGTAAGTTAAGTTAGTTAATTACCATTTGTAGCCTCCGACATCAAAAGCATCTGAAA
                      ____________________________________________________________
consensus GATGGTAAGTTAAGTTAGTTAATTACCATTTGTAGCCTCCGACATCAAAAGCATCTGAAA
 
. : . : . : . : . : . :
JMSF050O19+ TGTATTGGTCTATGTTGTTCCTGAGCAATGACACCGATTGAATCTTGACCACGTAGTGAC
JMSF050M15+ TGTATTGGTCTATGTTGTTCCTGAGCAATGACACCGATTGAATCTTGACCACGTAGTGAC
                      ____________________________________________________________
consensus TGTATTGGTCTATGTTGTTCCTGAGCAATGACACCGATTGAATCTTGACCACGTAGTGAC
 
. : . : . : . : . : . :
JMSF050O19+ TGGGGGGTGCGTCTGAAACTGTTTTCACAATTCCTTCTTCCTTTGGGGTATCAGCCATGG
JMSF050M15+ TGGGGGGTGCGTCTGAAACTGTTTTCACAATTCCTTCTTCCTTTGGGGTATCAGCCATGG
                      ____________________________________________________________
consensus TGGGGGGTGCGTCTGAAACTGTTTTCACAATTCCTTCTTCCTTTGGGGTATCAGCCATGG
 
. : . : . : . : . : . :
JMSF050O19+ AAAATAATTACTTTGCTATAAATATATATTAATTGAGAGTTTGTGTGGTTTGAGTTTACC
JMSF050M15+ AAAATAATTACTTTGCTATAAATATATATTAATTGAGAGTTTGTGTGGTTTGAGTTTACC
                      ____________________________________________________________
consensus AAAATAATTACTTTGCTATAAATATATATTAATTGAGAGTTTGTGTGGTTTGAGTTTACC