Previous Contig 008013:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029O20Sequence474008013 (2)gb:BT003324_16367487e-22Arabidopsis thaliana NADP-specific glutatamate dehydrogenase, putative (At1g5172810009613 (2)pir|B96556|B965562e-64hypothetical protein F19C24.7 [imported] - Arabidopsis thaliana>gb:AE005173_8930
JMSF050M13Sequence618008013 (2)gb:BT003324_16367485e-22Arabidopsis thaliana NADP-specific glutatamate dehydrogenase, putative (At1g5172747009613 (2)pir|B96556|B965566e-58hypothetical protein F19C24.7 [imported] - Arabidopsis thaliana>gb:AE005173_8930

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050M13+ TGACAACCTTTTTCTTCT
                      ____________________________________________________________
consensus TGACAACCTTTTTCTTCT
 
. : . : . : . : . : . :
JMFF029O20+ TCTTTGACATATCCTCACTGTCGGTAGGAAGTTGAGAAACCATCA
JMSF050M13+ TTTTCACTGGTTGTGTCTTTGACATATCCTCACTGTCGGTAGGAAGTTGAGAAACCATCA
                      ____________________________________________________________
consensus TTTTCACTGGTTGTGTCTTTGACATATCCTCACTGTCGGTAGGAAGTTGAGAAACCATCA
 
. : . : . : . : . : . :
JMFF029O20+ TGTGCTTGTTCTCTCTGTGCTCATCAGCTGAAGATTCTTGTGGTGTAACAGCAATCAGAC
JMSF050M13+ TGTGCTTGTTCTCTCTGTGCTCATCAGCTGAAGATTCTTGTGGTGTAACAGCAATCAGAC
                      ____________________________________________________________
consensus TGTGCTTGTTCTCTCTGTGCTCATCAGCTGAAGATTCTTGTGGTGTAACAGCAATCAGAC
 
. : . : . : . : . : . :
JMFF029O20+ TGTTCTGGGCAAACGAGTGGCCATCATCATCCCCCGGTCCAATTTCCAAATCAATCTCTT
JMSF050M13+ TGTTCTGGGCAAACGAGTGGCCATCATCATCCCCCGGTCCAATTTCCAAATCAATCTCTT
                      ____________________________________________________________
consensus TGTTCTGGGCAAACGAGTGGCCATCATCATCCCCCGGTCCAATTTCCAAATCAATCTCTT
 
. : . : . : . : . : . :
JMFF029O20+ CTATCTCCCTTACCACCAGGTGATGCCTCTGAGCCTGCTGAATCAAATTCATGTCATCCA
JMSF050M13+ CTATCTCCCTTACCACCAGGTGATGCCTCTGAGCCTGCTGAATCAAATTCATGTCATCCA
                      ____________________________________________________________
consensus CTATCTCCCTTACCACCAGGTGATGCCTCTGAGCCTGCTGAATCAAATTCATGTCATCCA
 
. : . : . : . : . : . :
JMFF029O20+ TTGTAGAATTCATCCCACCCCCACCGATGGGAAGCAGCATTCAGCATGACAATTTAGGAA
JMSF050M13+ TTGTAGAATTCATCCCACCCCCACCGATGGGAAGCAGCATTCAGCATGACAATTTAGGAA
                      ____________________________________________________________
consensus TTGTAGAATTCATCCCACCCCCACCGATGGGAAGCAGCATTCAGCATGACAATTTAGGAA
 
. : . : . : . : . : . :
JMFF029O20+ CAACTTGATTTTAACAGTCTGGAATTAAATTCCAAAGTCTGAGCTGCCCACGAGTCAGAA
JMSF050M13+ CAACTTGATTTTAACAGTCTGGAATTAAATTCCAAAGTCTGAGCTGCCCACGAGTCAGAA
                      ____________________________________________________________
consensus CAACTTGATTTTAACAGTCTGGAATTAAATTCCAAAGTCTGAGCTGCCCACGAGTCAGAA
 
. : . : . : . : . : . :
JMFF029O20+ GTCAGAACCCAGTCTTGCGGCGCCGTGTTCCCACGGGCCAATCGAGGAAAAGAAACCGAA
JMSF050M13+ GTCAGAACCCAGTCTTGCGGCGCCGTGTTCCCACGGGCCAATCGAGGAAAAGAAACCGAA
                      ____________________________________________________________
consensus GTCAGAACCCAGTCTTGCGGCGCCGTGTTCCCACGGGCCAATCGAGGAAAAGAAACCGAA
 
. : . : . : . : . : . :
JMFF029O20+ AAAAAGCTTGATTGAGTATGATCAGAAAATCCCCTGGAGCTGGGTGTATGAGTAGAAGGA
JMSF050M13+ AAAAAGCTTGATTGAGTATGATCAGAAAATCCCCTGGAGCTGGGTGTATGAGTAGAAGGA
                      ____________________________________________________________
consensus AAAAAGCTTGATTGAGTATGATCAGAAAATCCCCTGGAGCTGGGTGTATGAGTAGAAGGA
 
. : . : . : . : . : . :
JMFF029O20+ AGAGTAA
JMSF050M13+ AGAGTAATTAGAAAAGGAGAGTGATTGTGTGTGCATGCATGTTAGATGAATTGAGTGTAT
                      ____________________________________________________________
consensus AGAGTAATTAGAAAAGGAGAGTGATTGTGTGTGCATGCATGTTAGATGAATTGAGTGTAT
 
. : . : . : . : . : . :
JMSF050M13+ CGTCACTGCGGGTGAAAGAGACAAAGGTGGATGGATTCACAGACTTCAACTGTAACTCTC
                      ____________________________________________________________
consensus CGTCACTGCGGGTGAAAGAGACAAAGGTGGATGGATTCACAGACTTCAACTGTAACTCTC