Previous Contig 008012:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027H08Sequence576008012 (2)pir|T02602|T02602e-100vacuolar sorting receptor protein homolog At2g14740 - Arabidopsis thaliana>gb:AC747009501 (7)pir|T02604|T026042e-47probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMSF050M12Sequence697008012 (2)pir|T06794|T06794e-124vacuolar sorting receptor protein BP-80 - garden pea>gb:PSU79958_1702556 Pisum s768010136 (11)pir|T02602|T026028e-58vacuolar sorting receptor protein homolog At2g14740 - Arabidopsis thaliana>gb:AC

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027H08+ ACACAAGCAGAATAACTACGTCCATT
                      ____________________________________________________________
consensus ACACAAGCAGAATAACTACGTCCATT
 
. : . : . : . : . : . :
JMFF027H08+ TCGAGTTTCATGCCAACAGCCTCCATGATTCAGTTTGCATCGGCCTGGTCCACTTGGCTT
                      ____________________________________________________________
consensus TCGAGTTTCATGCCAACAGCCTCCATGATTCAGTTTGCATCGGCCTGGTCCACTTGGCTT
 
. : . : . : . : . : . :
JMFF027H08+ GCAAGAACTGTAGCCATCTCCTTTGAACTGCACACCATCAACCGTGGGGCATTCACAGAC
JMSF050M12+ AACTGCACACCATCAACCAAGGGGCACTCGCACAC
                      ____________________________________________________________
consensus GCAAGAACTGTAGCCATCTCCTTTGAACTGCACACCATCAACCGTGGGGCATTCGCAGAC
 
. : . : . : . : . : . :
JMFF027H08+ TCTTCCACGAAATGTATCCTTGCATGCTGTAATATTGGCTGATTTGTCTTGCCAGCAGCC
JMSF050M12+ TCTTCCCCGGAAAGTATCCTTGCAGGCTGTAATGTTGGCAGTTTCGTCTTGCCAGCAGCC
                      ____________________________________________________________
consensus TCTTCCCCGGAATGTATCCTTGCATGCTGTAATGTTGGCTGTTTTGTCTTGCCAGCAGCC
 
. : . : . : . : . : . :
JMFF027H08+ ACCATTATTGTCTAAGCACTCATTTGTCTCTAAATCATCACTCAAACAAACTACAGGCTC
JMSF050M12+ GCCATTGTGGTCTAAGCACTCATTTGTCTCCATTTCTCCATTAAGGCAAACTGCAGGCTC
                      ____________________________________________________________
consensus GCCATTGTTGTCTAAGCACTCATTTGTCTCTATTTCTTCATTCAGGCAAACTGCAGGCTC
 
. : . : . : . : . : . :
JMFF027H08+ TGTGGTTTCCTCAAAGCCAGCACAAATAGCCTTTAAAACAGCACCTTTCTCCAACTTCCC
JMSF050M12+ GGTAGTTTCCTCAAAACCAGCACAAATTGCCTTTAATACAGCACCTTTTGCCAACTTCCC
                      ____________________________________________________________
consensus TGTGGTTTCCTCAAAGCCAGCACAAATTGCCTTTAATACAGCACCTTTTTCCAACTTCCC
 
. : . : . : . : . : . :
JMFF027H08+ TCGGTATTGTCAGTTATTGACAACAAGGGTGGGCAATATAGTGACATCACCTCGCGATCC
JMSF050M12+ TCGGTACTGCCTATTGTTGACAACAAGGGTGGGCAATATGGTGACATCACCTCGTGATCC
                      ____________________________________________________________
consensus TCGGTATTGTCTGTTGTTGACAACAAGGGTGGGCAATATGGTGACATCACCTCGTGATCC
 
. : . : . : . : . : . :
JMFF027H08+ TTTACCAAGTTGAGCATCTTGCTCTTCTTTCAAAACAGGATTGTCAGCATCAGCACTAGG
JMSF050M12+ TTTACCAATTTGAGCATCTTGCTCTTCTTTCAAAACAGGATTATCAGCATCAGCATTGGG
                      ____________________________________________________________
consensus TTTACCAATTTGAGCATCTTGCTCTTCTTTCAAAACAGGATTGTCAGCATCAGCATTGGG
 
. : . : . : . : . : . :
JMFF027H08+ GTCTCCCATACACTTTTCAATCCCTTTCAAATCAAGACCTAAGGACTTGATGACTTCATC
JMSF050M12+ GTCTCCCATACAGTTCTCAATCTTTTTCAGATCAAGACCTAAAGAGTTGATGACACCATC
                      ____________________________________________________________
consensus GTCTCCCATACAGTTTTCAATCTTTTTCAGATCAAGACCTAAGGAGTTGATGACTTCATC
 
. : . : . : . : . : . :
JMFF027H08+ AGCACATTCCTTGTTATATTTCTTCTCTTTCATGGGACATCGAATTTGGAAATCAGTCAC
JMSF050M12+ AGCACATTCCTTGTTATATTTCTTATCTTTCATGGGGCAGCGGATTTGGAAATCAGTCAC
                      ____________________________________________________________
consensus AGCACATTCCTTGTTATATTTCTTCTCTTTCATGGGGCATCGGATTTGGAAATCAGTCAC
 
. : . : . : . : . : . :
JMFF027H08+ GTAATCCCAC
JMSF050M12+ ATAATCCCACCAAATCCATGGCTTTTTGGTCTCTTTGGCAACTTTAAAGACACAAAGTTG
                      ____________________________________________________________
consensus GTAATCCCACCAAATCCATGGCTTTTTGGTCTCTTTGGCAACTTTAAAGACACAAAGTTG
 
. : . : . : . : . : . :
JMSF050M12+ CCTTAAATTTTCAATAACAACATCCTTCCCATCATAACCCGAGCTAAAATCCTGTTCAGG
                      ____________________________________________________________
consensus CCTTAAATTTTCAATAACAACATCCTTCCCATCATAACCCGAGCTAAAATCCTGTTCAGG
 
. : . : . : . : . : . :
JMSF050M12+ ATCAGGAGCACAATATCTCCCGTGATTAATGCATTGCTGCTTGCATTGTCTGCTTACTGT
                      ____________________________________________________________
consensus ATCAGGAGCACAATATCTCCCGTGATTAATGCATTGCTGCTTGCATTGTCTGCTTACTGT
 
. : . : . : . : . : . :
JMSF050M12+ AAATGCCTGAGGACAATACCAAGTTATATAGTGAGGTGTGAATTCAGTGTAGCCACCTTT
                      ____________________________________________________________
consensus AAATGCCTGAGGACAATACCAAGTTATATAGTGAGGTGTGAATTCAGTGTAGCCACCTTT