Previous Contig 008011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030F01Sequence394008011 (3)pir|T00979|T009797e-15hypothetical protein At2g26460 [imported] - Arabidopsis thaliana>gb:AC002505_153
JMSF050L18Sequence690008011 (3)pir|T00979|T009797e-57hypothetical protein At2g26460 [imported] - Arabidopsis thaliana>gb:AC002505_153763013900 (3)pir|T00979|T009799e-64hypothetical protein At2g26460 [imported] - Arabidopsis thaliana>gb:AC002505_153
JMSF052B15Sequence716008011 (3)pir|T00979|T009791e-63hypothetical protein At2g26460 [imported] - Arabidopsis thaliana>gb:AC002505_153889013900 (3)pir|T00979|T009791e-77hypothetical protein At2g26460 [imported] - Arabidopsis thaliana>gb:AC002505_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052B15+ TNTAAGACAGAGC
                      ____________________________________________________________
consensus TNTAAGACAGAGC
 
. : . : . : . : . : . :
JMSF052B15+ CATCAACACCGACAGTAACCATTTCCTCGGGGACAGGACAGTCAGCTTTACTCCTGTGGA
JMSF050L18+ GGACAGGACAGTCAGCTTTACTCCTGTGGA
                      ____________________________________________________________
consensus CATCAACACCGACAGTAACCATTTCCTCGGGGACAGGACAGTCAGCTTTACTCCTGTGGA
 
. : . : . : . : . : . :
JMSF052B15+ CAGTCGTGGGAATATCATTGGAAAATCCACTTTCCATGTTAAAAATAAAAGCCATCCTTC
JMSF050L18+ CAGTCGTGGGAATATCATTGGAAAATCCACTTTCCATGTTAAAAATAAAAGCCATCCTTC
                      ____________________________________________________________
consensus CAGTCGTGGGAATATCATTGGAAAATCCACTTTCCATGTTAAAAATAAAAGCCATCCTTC
 
. : . : . : . : . : . :
JMSF052B15+ CAGGAAGGAACATTTCATTGGTCTTTACAACAGTCGGGGGCTTGACTATCCACTTGTAGA
JMSF050L18+ CAGGAAGGAACATTTCATTGGTCTTTACAACAGTCGGGGGCTTGACTATCCACTTGTAGA
                      ____________________________________________________________
consensus CAGGAAGGAACATTTCATTGGTCTTTACAACAGTCGGGGGCTTGACTATCCACTTGTAGA
 
. : . : . : . : . : . :
JMSF052B15+ CTGACTTTGCAGTGGCAGTGCGGAAAGCAAGTGTTTGATCTTCCTTTGATGCTCTAGATT
JMSF050L18+ CTGACTTTGCAGTGGCAGTGCGGAAAGCAAGTGTTTGATCTTCCTTTGATGCTCTAGATT
                      ____________________________________________________________
consensus CTGACTTTGCAGTGGCAGTGCGGAAAGCAAGTGTTTGATCTTCCTTTGATGCTCTAGATT
 
. : . : . : . : . : . :
JMSF052B15+ TTCCATCAGAATCATCTCCAACATCTGGCTTCTTATCTATTTCACTTCTCACTTTATGAA
JMSF050L18+ TTCCATCAGAATCATCTCCAACATCTGGCTTCTTATCTATTTCACTTCTCACTTTATGAA
                      ____________________________________________________________
consensus TTCCATCAGAATCATCTCCAACATCTGGCTTCTTATCTATTTCACTTCTCACTTTATGAA
 
. : . : . : . : . : . :
JMSF052B15+ GCAAAGCATAATCCAATCCTTTAACCAAGTGCGTGTGCTCCACATCACCTCCAAGATACT
JMFF030F01+ AACCAAGTGCGTGTGCTCCACATCACCTCCAAGATACT
JMSF050L18+ GCAAAGCATAATCCAATCCTTTAACCAAGTGCGTGTGCTCCACATCACCTCCAAGATACT
                      ____________________________________________________________
consensus GCAAAGCATAATCCAATCCTTTAACCAAGTGCGTGTGCTCCACATCACCTCCAAGATACT
 
. : . : . : . : . : . :
JMSF052B15+ TGCTCTTCTCAATAGATAACTTGTGAGCATCAGCACCGATATCCGTACCGGGAGGACGAA
JMFF030F01+ TGCTCTTCTCAATAGATAACTTGTGAGCATCAGCACCGATATCCGTACCGGGAGGACGAA
JMSF050L18+ TGCTCTTCTCAATAGATAACTTGTGAGCATCAGCACCGATATCCGTACCGGGAGGACGAA
                      ____________________________________________________________
consensus TGCTCTTCTCAATAGATAACTTGTGAGCATCAGCACCGATATCCGTACCGGGAGGACGAA
 
. : . : . : . : . : . :
JMSF052B15+ CGTTATGATAGGCACCCGATTCCACGTAATCGGGATTTTGATCCTCCCTCCTCTCTTTGG
JMFF030F01+ CGTTATGATAGGCACCCGATTCCACGTAATCGGGATTTTGATCCTCCCTCCTCTCTTTGG
JMSF050L18+ CGTTATGATAGGCACCCGATTCCACGTAATCGGGATTTTGATCCTCCCTCCTCTCTTTGG
                      ____________________________________________________________
consensus CGTTATGATAGGCACCCGATTCCACGTAATCGGGATTTTGATCCTCCCTCCTCTCTTTGG
 
. : . : . : . : . : . :
JMSF052B15+ CTCTGTCTCTGTACTTGGGTTGCTCTGGTTCTTCTGCTTTCTCCTCTTTGTTGCGACGAA
JMFF030F01+ CTCTGTCTCTGTACTTGGGTTGCTCTGGTTCTTCTGCTTTCTCCTCTTTGTTGCGACGAA
JMSF050L18+ CTCTGTCTCTGTACTTGGGTTGCTCTGGTTCTTCTGCTTTCTCCTCTTTGTTGCGACGAA
                      ____________________________________________________________
consensus CTCTGTCTCTGTACTTGGGTTGCTCTGGTTCTTCTGCTTTCTCCTCTTTGTTGCGACGAA
 
. : . : . : . : . : . :
JMSF052B15+ TTATCTTCTCTTTGTGATTTCGCTTCGAGGCTGTCATCTTCGAAACAGTCTCGACGAATC
JMFF030F01+ TTATCTTCTCTTTGTGATTTCGCTTCGAGGCTGTCATCTTCGAAACAGTCTCGACGAATC
JMSF050L18+ TTATCTTCTCTTTGTGATTTCGCTTCGAGGCTGTCATCTTCGAAACAGTCTCGACGAATC
                      ____________________________________________________________
consensus TTATCTTCTCTTTGTGATTTCGCTTCGAGGCTGTCATCTTCGAAACAGTCTCGACGAATC
 
. : . : . : . : . : . :
JMSF052B15+ ACCAGTGCGGCTGATTTCAGACGAAAAATTAAATTTACCAGATTAAATTAACCACTCTGG
JMFF030F01+ ACCAGTGCGGCTGATTTCAGACGAAAAATTAAATTTACCAGATTAAATTAACCACTCTGG
JMSF050L18+ ACCAGTGCGGCTGATTTCAGACGAAAAATTAAATTTACCAGATTAAATTAACCACTCTGG
                      ____________________________________________________________
consensus ACCAGTGCGGCTGATTTCAGACGAAAAATTAAATTTACCAGATTAAATTAACCACTCTGG
 
. : . : . : . : . : . :
JMSF052B15+ ACAAAAGTTACATAGCAGAGTTCGAAGCTCGCTCGTCCGCTC
JMFF030F01+ ACAAAAGTTACATAGCAGAGTTCGAAGCTCGCTCGTCCGCTCACTGGTTCCCGAAC
JMSF050L18+ ACAAAAGTTACATAGCAGAGTTCGAAGCTCGCTCGTCCGCTCACTGGTTCCCGAACAATC
                      ____________________________________________________________
consensus ACAAAAGTTACATAGCAGAGTTCGAAGCTCGCTCGTCCGCTCACTGGTTCCCGAACAATC