Previous Contig 008008:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004N07Sequence234008008 (3)pir|T45647|T456472e-10receptor protein kinase-like protein - Arabidopsis thaliana>gb:ATF13I12_1548472
JMSF050L03Sequence685008008 (3)gb:AP004063_18371064e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14776013997 (2)gb:AP003491_18299472e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P066
JMSF052F06Sequence720008008 (3)gb:AP004063_18371065e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ14958013997 (2)gb:AP003491_18299473e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P066

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052F06+ AA
                      ____________________________________________________________
consensus AA
 
. : . : . : . : . : . :
JMSF052F06+ ATGAAGATTCCCTTGTAAACTCAAATATTCCAAGGTGGGAAATGTTGGAGATTGTGGATG
JMSF050L03+ GGAAATGTTGGAGATTGTGGATG
                      ____________________________________________________________
consensus ATGAAGATTCCCTTGTAAACTCAAATATTCCAAGGTGGGAAATGTTGGAGATTGTGGATG
 
. : . : . : . : . : . :
JMSF052F06+ GGATAGGGCCAGATAATTTATTAAAATCCAAAACTAGCTTCTTGAGAAAATGAAGCTTGC
JMSF050L03+ GGATAGGGCCAGATAATTTATTAAAATCCAAAACTAGCTTCTTGAGAAAATGAAGCTTGC
                      ____________________________________________________________
consensus GGATAGGGCCAGATAATTTATTAAAATCCAAAACTAGCTTCTTGAGAAAATGAAGCTTGC
 
. : . : . : . : . : . :
JMSF052F06+ CAATATCCTTAGGAATATGGCCTTCTATAAGATTGGATGTGAAGTTTAAGGCTTCAAGAT
JMSF050L03+ CAATATCCTTAGGAATATGGCCTTCTATAAGATTGGATGTGAAGTTTAAGGCTTCAAGAT
                      ____________________________________________________________
consensus CAATATCCTTAGGAATATGGCCTTCTATAAGATTGGATGTGAAGTTTAAGGCTTCAAGAT
 
. : . : . : . : . : . :
JMSF052F06+ TTGACAAGTTTAGAAACGAAAGTGGGATAGAACCTGTAAACCCATTATGACCAAGATTCA
JMSF050L03+ TTGACAAGTTTAGAAACGAAAGTGGGATAGAACCTGTAAACCCATTATGACCAAGATTCA
                      ____________________________________________________________
consensus TTGACAAGTTTAGAAACGAAAGTGGGATAGAACCTGTAAACCCATTATGACCAAGATTCA
 
. : . : . : . : . : . :
JMSF052F06+ ATATTTGGAGATTGGATAGGAACCCAAACCACGAAGGGACTTCTCCAGAAAGATTGTTGG
JMSF050L03+ ATATTTGGAGATTGGATAGGAACCCAAACCACGAAGGGACTTCTCCAGAAAGATTGTTGG
                      ____________________________________________________________
consensus ATATTTGGAGATTGGATAGGAACCCAAACCACGAAGGGACTTCTCCAGAAAGATTGTTGG
 
. : . : . : . : . : . :
JMSF052F06+ CACTAAAATCAAAAGCTCTCAATCTACGCAAATGATTTAATTCACTAGGTAAAACCCCAA
JMSF050L03+ CACTAAAATCAAAAGCTCTCAATCTACGCAAATGATTTAATTCACTAGGTAAAACCCCAA
                      ____________________________________________________________
consensus CACTAAAATCAAAAGCTCTCAATCTACGCAAATGATTTAATTCACTAGGTAAAACCCCAA
 
. : . : . : . : . : . :
JMSF004N07+ TTGAGAGAGACGAGAAACGAGAGATTTCCAAACTAGGAAG
JMSF052F06+ CAAAATTATTGCCACTTGCATTGAGAGAGACGAGAAACGAGAGATTTCCAAACTAGGAAG
JMSF050L03+ CAAAATTATTGCCACTTGCATTGAGAGAGACGAGAAACGAGAGATTTCCAAACTAGGAAG
                      ____________________________________________________________
consensus CAAAATTATTGCCACTTGCATTGAGAGAGACGAGAAACGAGAGATTTCCAAACTAGGAAG
 
. : . : . : . : . : . :
JMSF004N07+ GAATGGTTCCAGAAAGTCCCATTTGAGAGATATCTAAAGCAGTCACTCGTCGATGACGAG
JMSF052F06+ GAATGGTTCCAGAAAGTCCCATTTGAGAGATATCTAAAGCAGTCACTCGTCGATGACGAG
JMSF050L03+ GAATGGTTCCAGAAAGTCCCATTTGAGAGATATCTAAAGCAGTCACTCGTCGATGACGAG
                      ____________________________________________________________
consensus GAATGGTTCCAGAAAGTCCCATTTGAGAGATATCTAAAGCAGTCACTCGTCGATGACGAG
 
. : . : . : . : . : . :
JMSF004N07+ AGCCACATGTGACTCCAACCCACTCACACACTGAGGAAGCATTAGACCAGTTGGTCATTA
JMSF052F06+ AGCCACATGTGACTCCAACCCACTCACACACTGAGGAAGCATTAGACCAGTTGGTCATTA
JMSF050L03+ AGCCACATGTGACTCCAACCCACTCACACACTGAGGAAGCACTAGACCAGTTGGTCATTA
                      ____________________________________________________________
consensus AGCCACATGTGACTCCAACCCACTCACACACTGAGGAAGCATTAGACCAGTTGGTCATTA
 
. : . : . : . : . : . :
JMSF004N07+ TGATGGGACTAGTGTGTATGTTAATAGTAGATTTCAAGGCAAGAAGAGAAGACGCATCAG
JMSF052F06+ TGATGGGACTAGTGTGTATGTTAATAGTAGATTTCAAGGCAAGAAGAGAAGACGCATCAG
JMSF050L03+ TGATGGGACTAGTGTGTATGTTAATAGTAGATTTCAAGGCAAGAAGAGAAGACGCATCAG
                      ____________________________________________________________
consensus TGATGGGACTAGTGTGTATGTTAATAGTAGATTTCAAGGCAAGAAGAGAAGACGCATCAG
 
. : . : . : . : . : . :
JMSF004N07+ CAGTAATGTTCA
JMSF052F06+ CAGTAATGTTCATGGCTGAGCAAACCGTTACAGAGAATAATAATAAAGCCAGAGGAAATA
JMSF050L03+ CAGTAATGTTCATGGCTGAGCAAACCGTTACAGAGAATAATAATAAAGCCAGAGGAAATA
                      ____________________________________________________________
consensus CAGTAATGTTCATGGCTGAGCAAACCGTTACAGAGAATAATAATAAAGCCAGAGGAAATA
 
. : . : . : . : . : . :
JMSF052F06+ ATGAAAAACATAGCTTCATCATCATTGAGAGCAATAATTGTGCGGTGTAGATAAGCAG
JMSF050L03+ ATGAAAAACATAGCTTCATCATCATTGAGAGCAATAATTGTGCGGTGTAGATAAGCAGCC
                      ____________________________________________________________
consensus ATGAAAAACATAGCTTCATCATCATTGAGAGCAATAATTGTGCGGTGTAGATAAGCAGCC