Previous Contig 008004:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014C11Sequence479008004 (4)gb:AX772727_14748933e-19Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0800011773 (2)gb:AX772727_14748935e-95Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0
JMSF041J10Sequence757008004 (4)gb:AX772727_14748931e-35Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0794013356 (2)gb:AX772727_14748933e-54Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0
JMSF050J15Sequence624008004 (4)gb:AX772727_14748932e-42Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0783013356 (2)gb:AX772727_14748932e-87Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0
JMSF050O23Sequence653008004 (4)gb:AX772727_14748931e-51Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0648011773 (2)gb:AX772727_14748938e-71Sequence 1 from Patent EP1318192.>gb:AX776322_1475333 Sequence 1 from Patent WO0

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041J10+ TGCAAACATTATATACTATGAACGATTTATCATGTCATCTAAATGCTACTCCTAT
                      ____________________________________________________________
consensus TGCAAACATTATATACTATGAACGATTTATCATGTCATCTAAATGCTACTCCTAT
 
. : . : . : . : . : . :
JMSF041J10+ GAACGAAAAACGGGCAGAACATAGATAGCTTTCCTACTCAAAAGAAAATTCAGCAGAATA
                      ____________________________________________________________
consensus GAACGAAAAACGGGCAGAACATAGATAGCTTTCCTACTCAAAAGAAAATTCAGCAGAATA
 
. : . : . : . : . : . :
JMSF041J10+ CACAGCTTTGCAAGATGAACAATCTAACAATAATACTGAAAAGAAATAAGCTTTTAGTGT
                      ____________________________________________________________
consensus CACAGCTTTGCAAGATGAACAATCTAACAATAATACTGAAAAGAAATAAGCTTTTAGTGT
 
. : . : . : . : . : . :
JMSF050O23+ CTTGTCGATTCCAATGTCATATATCTGATTTATGCCCACAATATAACCATT
JMSF041J10+ TTGCTATTACTTGTCGATTCCAATGTCATATATCTGATTTATGCCCACAATATAACCATT
JMSF050J15+ CTTGTCGATTCCAATGTCATATATCTGATTTATGCCCACAATATAACCATT
                      ____________________________________________________________
consensus TTGCTATTACTTGTCGATTCCAATGTCATATATCTGATTTATGCCCACAATATAACCATT
 
. : . : . : . : . : . :
JMSF050O23+ GCCACATATAAGAGCAAAGAGTCCAGAAAATGCCTTGAGTAACAATGACCACCTAATCAG
JMSF014C11+ AGTAACAATGACCACCTAATCAG
JMSF041J10+ GCCACATATAAGAGCAAAGAGTCCAGAAAATGCCTTGAGTAACAATGACCACCTAATCAG
JMSF050J15+ GCCACATATAAGAGCAAAGAGTCCAGAAAATGCCTTGAGTAACAATGACCACCTAATCAG
                      ____________________________________________________________
consensus GCCACATATAAGAGCAAAGAGTCCAGAAAATGCCTTGAGTAACAATGACCACCTAATCAG
 
. : . : . : . : . : . :
JMSF050O23+ ATTCGGGTTCTCAATTAGAGCTCTCGTTACCAATGAAGCAGATCCTAATGCTGTTCCGCG
JMSF014C11+ ATTCGGGTTCTCAATTAGAGCTCTCGTTACCAATGAAGCAGATCCTAATGCTGTTCCGCG
JMSF041J10+ ATTCGGGTTCTCAATTAGAGCTCTCGTTACCAATGAAGCAGATCCTAATGCTGTTCCGCG
JMSF050J15+ ATTCGGGTTCTCAATTAGAGCTCTCGTTACCAATGAAGCAGATCCTAATGCTGTTCCGCG
                      ____________________________________________________________
consensus ATTCGGGTTCTCAATTAGAGCTCTCGTTACCAATGAAGCAGATCCTAATGCTGTTCCGCG
 
. : . : . : . : . : . :
JMSF050O23+ TATCGTATGGGGCCTCAAGAATCTCCAAAAGGCATCTTTGAACTGCGAAACTTTATCCAA
JMSF014C11+ TATCGTATGGGGCCTCAAGAATCTCCAAAAGGCATCTTTGAACTGCGAAACTTTATCCAA
JMSF041J10+ TATCGTATGGGGCCTCAAGAATCTCCAAAAGGCATCTTTGAACTGCGAAACTTTATCCAA
JMSF050J15+ TATCGTATGGGGCCTCAAGAATCTCCAAAAGGCATCTTTGAACTGCGAAACTTTATCCAA
                      ____________________________________________________________
consensus TATCGTATGGGGCCTCAAGAATCTCCAAAAGGCATCTTTGAACTGCGAAACTTTATCCAA
 
. : . : . : . : . : . :
JMSF050O23+ AATTGGGGCAGATCCGGCATCGCCAACTTGAGAGCAGGCCCAGATGGAGCTGCGTCTATA
JMSF014C11+ AATTGGGGCAGATCCGGCATCGCCAACTTGAGAGCAGGCCCAGATGGAGCTGCGTCTATA
JMSF041J10+ AATTGGGGCAGATCCGGCATCGCCAACTTGAGAGCAGGCCCAGATGGAGCTGCGTCTATA
JMSF050J15+ AATTGGGGCAGATCCGGCATCGCCAACTTGAGAGCAGGCCCAGATGGAGCTGCGTCTATA
                      ____________________________________________________________
consensus AATTGGGGCAGATCCGGCATCGCCAACTTGAGAGCAGGCCCAGATGGAGCTGCGTCTATA
 
. : . : . : . : . : . :
JMSF050O23+ CATTCCGAATGGAGCATTTTTCGAGAAGGTTCTGGAATTGTGAAGCCCAACTGAAGAGCG
JMSF014C11+ CATTCCGAATGGAGCATTTTTCGAGAAGGTTCTGGAATTGTGAAGCCCAACTGAAGAGCG
JMSF041J10+ CATTCCGAATGGAGCATTTTTCGAGAAGGTTCTGGAATTGTGAAGCCCAACTGAAGAGCG
JMSF050J15+ CATTCCGAATGGAGCATTTTTCGAGAAGGTTCTGGAATTGTGAAGCCCAACTGAAGAGCG
                      ____________________________________________________________
consensus CATTCCGAATGGAGCATTTTTCGAGAAGGTTCTGGAATTGTGAAGCCCAACTGAAGAGCG
 
. : . : . : . : . : . :
JMSF050O23+ CAAGGTTTTGGAAGGTTTGAGTAGGGCCAAGTTAGCAGCTTTGCAAGTGGACCAAATGGA
JMSF014C11+ CAAGGTTTTGGAAGGTTTGAGTAGGGCCAAGTTAGCAGCTTTGCAAGTGGACCAAATGGA
JMSF041J10+ CAAGGTTTTGGAAGGTTTGAGTAGGGCCAAGTTAGCAGCTTTGCAAGTGGACCAAATGGA
JMSF050J15+ CAAGGTTTTGGAAGGTTTGAGTAGGGCCAAGTTAGCAGCTTTGCAAGTGGACCAAATGGA
                      ____________________________________________________________
consensus CAAGGTTTTGGAAGGTTTGAGTAGGGCCAAGTTAGCAGCTTTGCAAGTGGACCAAATGGA
 
. : . : . : . : . : . :
JMSF050O23+ TAATTTTCTTGAACACGAAGGGGTTCCGTTGTAATTAAACACAGATGAAATCCGACTTGA
JMSF014C11+ TAATTTTCTTGAACACGAAGGGGTTCCGTTGTAATTAAACACAGATGAAATCCGACTTGA
JMSF041J10+ TAATTTTCTTGAACACGAAGGGGTTCCGTTGTAATTAAACACAGATGAAATCCGACTTGA
JMSF050J15+ TAATTTTCTTGAACACGAAGGGGTCCCGTTGTAATTAAACACAGATGAAATCCGACTTGA
                      ____________________________________________________________
consensus TAATTTTCTTGAACACGAAGGGGTTCCGTTGTAATTAAACACAGATGAAATCCGACTTGA
 
. : . : . : . : . : . :
JMSF050O23+ CGAACAAGATGAGCACGCTAACTCCATCCCCAGAAACACAGAAACCAGAAATTGAGGTGA
JMSF014C11+ CGAACAAGATGAGCACGCTAACTCCATCCCCAGAAACACAGAAACCAGAAATTGAGGTGA
JMSF041J10+ CGAACAAGATGAGCACGCTAACTCCATCCCCAGAAACACAGAAACCAGAAATTGAGGTGA
JMSF050J15+ CGAACAAGATGAGCACGCTAACTCCATCCCCAGAAACACAGAAACCAGAAATTGAGGTGA
                      ____________________________________________________________
consensus CGAACAAGATGAGCACGCTAACTCCATCCCCAGAAACACAGAAACCAGAAATTGAGGTGA
 
. : . : . : . : . : . :
JMSF050O23+ TTAGAGGCGCGGGGACGAGTAGCTTGTGAACCA
JMSF014C11+ TTAGAGGCGCGGGGACGAGTAGCTTGTGAACCA
JMSF041J10+ TTAGAGGCGCGGGGACGAGTAGCTTGTGAACCA
JMSF050J15+ TTAGAGGCGCGGGGACGAGTAGCTTGTGAACCAACAGCTTCAGTGGAGCTCCGGTGTCAC
                      ____________________________________________________________
consensus TTAGAGGCGCGGGGACGAGTAGCTTGTGAACCAACAGCTTCAGTGGAGCTCCGGTGTCAC