Previous Contig 008002:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029M05Sequence533008002 (4)745009676 (4)gb:AK117483_18155164e-88Arabidopsis thaliana At5g48150 mRNA for putative SCARECROW gene regulator, compl
JMFF031H17Sequence522008002 (4)759009676 (4)gb:AK117483_18155166e-69Arabidopsis thaliana At5g48150 mRNA for putative SCARECROW gene regulator, compl
JMSF047F22Sequence691008002 (4)gb:AY062210_15650053e-08Oryza sativa chitin-inducible gibberellin-responsive protein (GIGR2) mRNA, compl721009676 (4)gb:AK117483_18155164e-88Arabidopsis thaliana At5g48150 mRNA for putative SCARECROW gene regulator, compl
JMSF050I19Sequence712008002 (4)gb:BT001076_16353312e-05Arabidopsis thaliana At4g17230/dl4650c mRNA, complete cds.>gb:AF419570_1798432 A777009676 (4)gb:AK117483_18155164e-88Arabidopsis thaliana At5g48150 mRNA for putative SCARECROW gene regulator, compl

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047F22+ CAAATCCCCGACGGGTATGCCTTCCATCATTTCT
                      ____________________________________________________________
consensus CAAATCCCCGACGGGTATGCCTTCCATCATTTCT
 
. : . : . : . : . : . :
JMSF047F22+ CTCCAGCTGTCCAATTCTGGTGGGGCGATAGTGCTTGGCAAGGTTAGTTCATAGCACTCG
JMSF050I19+ CTCG
                      ____________________________________________________________
consensus CTCCAGCTGTCCAATTCTGGTGGGGCGATAGTGCTTGGCAAGGTTAGTTCATAGCACTCG
 
. : . : . : . : . : . :
JMSF047F22+ GGGACATCTGAGTCAGGTCCAAGCATTACACTCTCGAGTTCCTTTAACTTGTGCCTGAAA
JMSF050I19+ GGGACATNTGAGTCAGGTCCAAGCATTACACTCTCGAGTTCCTTTAACTTGTGCCTGAAA
                      ____________________________________________________________
consensus GGGACATCTGAGTCAGGTCCAAGCATTACACTCTCGAGTTCCTTTAACTTGTGCCTGAAA
 
. : . : . : . : . : . :
JMSF047F22+ TCACTCATGTCATCCGTAACGGAAGACACACTGATTGGAGAACTATACTTGGTTTCTGGA
JMSF050I19+ TCACTCATGTCATCCGTAACGGAAGACACACTGATTGGAGAACTATACTTGGTTTCTGGA
                      ____________________________________________________________
consensus TCACTCATGTCATCCGTAACGGAAGACACACTGATTGGAGAACTATACTTGGTTTCTGGA
 
. : . : . : . : . : . :
JMSF047F22+ GATTGGTGTAGTAGGTCCAACGGGTACGATTGGAATTCTTGTTGCAACATGGGACTT-CC
JMFF029M05+ ACATGGGACTTCCC
JMSF050I19+ GATTGGTGTAGTAGGTCCAACGGGTACGATTGGAATTCTTGTTGCAACATGGGACTT-CC
                      ____________________________________________________________
consensus GATTGGTGTAGTAGGTCCAACGGGTACGATTGGAATTCTTGTTGCAACATGGGACTT-CC
 
. : . : . : . : . : . :
JMSF047F22+ ATACGGTGAGAAAGTGACGGTTGACGATGAGTTGCAACGAGCATGACTGCCATTTTTCGA
JMFF031H17+ GGTGAGAAAGTGACGGTTGACGATGAGTTGCAACGAGCATGACTGCCATTTTTCGA
JMFF029M05+ ATACGGTGAGAAAGTGACGGTTGACGATGAGTTGCAACGAGCATGACTGCCATTTTTCGA
JMSF050I19+ ATACGGTGAGAAAGTGACGGTTGACGATGAGTTGCAACGAGCATGACTGCCATTTTTCGA
                      ____________________________________________________________
consensus ATACGGTGAGAAAGTGACGGTTGACGATGAGTTGCAACGAGCATGACTGCCATTTTTCGA
 
. : . : . : . : . : . :
JMSF047F22+ GGACAATTCCCGATCAGAATAAGCCTGGATCAAGTAGCTGCCCCCGTTGTCACTGCTACT
JMFF031H17+ GGACAATTCCCGATCAGAATAAGCCTGGATCAAGTAGCTGCCCCCGTTGTCACTGCTACT
JMFF029M05+ GGACAATTCCCGATCAGAATAAGCCTGGATCAAGTAGCTGCCCCCGTTGTCACTGCTACT
JMSF050I19+ GGACAATTCCCGATCAGAATAAGCCTGGATCAAGTAGCTGCCCCCGTTGTCACTGCTACT
                      ____________________________________________________________
consensus GGACAATTCCCGATCAGAATAAGCCTGGATCAAGTAGCTGCCCCCGTTGTCACTGCTACT
 
. : . : . : . : . : . :
JMSF047F22+ GTGGCTCAGCTGGTCTAAAATTTGAAACTGAGGCACACAGTAGGCCTCGGCCTTTTGCTG
JMFF031H17+ TTGGCTCAGCTGGTCTAAAATTTGAAACTGAGGCACACAGTAGGCCTCGGCCTTTTGCTG
JMFF029M05+ GTGGCTCAGCTGGTCTAAAATTTGAAACTGAGGCACACAGTAGGCCTCGGCCTTTTGCTG
JMSF050I19+ GTGGCTCAGCTGGTCTAAAATTTGAAACTGAGGCACACAGTAGGCCTCGGCCTTTTGCTG
                      ____________________________________________________________
consensus GTGGCTCAGCTGGTCTAAAATTTGAAACTGAGGCACACAGTAGGCCTCGGCCTTTTGCTG
 
. : . : . : . : . : . :
JMSF047F22+ AAAGCACAGCGTATTGGACATCCCTGTTCTCC
JMFF031H17+ AAAGCACAGCGTATTGGACATCCCTGTTCTCCTGAGACGTGATGCTTGCATTTAAAAGGT
JMFF029M05+ AAAGCACAGCGTATTGGACATCCCTGTTCTCCTGAGACGTGATGCTTGCATTTAAAAGGT
JMSF050I19+ AAAGCACAGCGTATTGGACATCCCTGTTCTCCTGAGACGTGATGCTTGCATTTAAAAGGT
                      ____________________________________________________________
consensus AAAGCACAGCGTATTGGACATCCCTGTTCTCCTGAGACGTGATGCTTGCATTTAAAAGGT
 
. : . : . : . : . : . :
JMFF031H17+ TTCGATACAGATAACTCATACAACTCTGGCCAAGAATTGATGTAATCGAAGGATCTCTAA
JMFF029M05+ TTCGATACAGATAACTCATACAACTCTGGCCAAGAATTGATGTAATCGAAGGATCTCTAA
JMSF050I19+ TTCGATACAGATAACTCATACAACTCTGGCCAAGAATTGATGTAATCGAAGGATCTCTAA
                      ____________________________________________________________
consensus TTCGATACAGATAACTCATACAACTCTGGCCAAGAATTGATGTAATCGAAGGATCTCTAA
 
. : . : . : . : . : . :
JMFF031H17+ TAGTAGGAAAAGTAGTTTACCAAAAGTAATGCCACGCCATTCTTGGTGATAAACCTCAGC
JMFF029M05+ TAGTAGGAAAAGTAGTTTACCAAAAGTAATGCCACGCCATTCTTGGTGATAAACCTCAGC
JMSF050I19+ TAGTAGGAAAAGTAGTTTACCAAAAGTAATGCCACGCCATTCTTGGTGATAAACCTCAGC
                      ____________________________________________________________
consensus TAGTAGGAAAAGTAGTTTACCAAAAGTAATGCCACGCCATTCTTGGTGATAAACCTCAGC
 
. : . : . : . : . : . :
JMFF031H17+ AAAAAAGATTCCTCTTCTGAAAACCTTGGAAACACCCACCTCACCCCC-----------A
JMFF029M05+ AAAAAAGATTCCTCTTCTGAAAACCTTGGAAACACCCACCTCACCCCCACCTTATACCAA
JMSF050I19+ AAAAAAGATTCCTCTTCTGAAAACCTTGGAAACACCCACCTCACCCCC-----------A
                      ____________________________________________________________
consensus AAAAAAGATTCCTCTTCTGAAAACCTTGGAAACACCCACCTCACCCCC-----------A
 
. : . : . : . : . : . :
JMFF031H17+ CCTTAAACTGAAGAATCCCGCGTTATCATAAGATTTCTTTCTTTATTACACTCAAAAGCA
JMFF029M05+ CCTTAAACTGAAGAATCCCGCGTTATCATAAGATTTCTTTCTTTATTACACTCAAAAGCA
JMSF050I19+ CCTTAAACTGAAGAATCCCGCGTTATCATAAGATTTCTTTCTTTATTACACTCAAAAGCA
                      ____________________________________________________________
consensus CCTTAAACTGAAGAATCCCGCGTTATCATAAGATTTCTTTCTTTATTACACTCAAAAGCA
 
. : . : . : . : . : . :
JMFF031H17+ TAGCCGAGAACGATAGAGAAGAAGAGAAGAAGAAGAAGCAGAGCATAGAGCTCCCCT
JMFF029M05+ TAGCCGAGAACGATAGAGAAGAAGAGAAGAAGAAGAAGC
JMSF050I19+ TAGCCGAGAACGATAGAGAAGAAGAGAAGAAGAAGAAGCAGAGCATAGAGCTCCCCTGTC
                      ____________________________________________________________
consensus TAGCCGAGAACGATAGAGAAGAAGAGAAGAAGAAGAAGCAGAGCATAGAGCTCCCCTGTC