Previous Contig 007998:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H09Sequence603007998 (18)gb:STPORIN2_17228723e-84S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFF008M07Sequence491007998 (18)gb:STPORIN2_17228721e-66S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFF028F06Sequence520007998 (18)gb:STPORIN2_17228724e-72S.tuberosum pPOM36II mRNA for 36kDa porinII.716007998 (18)gb:STPORIN2_17228721e-66S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFF031B02Sequence537007998 (18)gb:STPORIN2_17228722e-74S.tuberosum pPOM36II mRNA for 36kDa porinII.727007998 (18)gb:STPORIN2_17228721e-73S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFF033I02Sequence541007998 (18)gb:STPORIN2_17228728e-74S.tuberosum pPOM36II mRNA for 36kDa porinII.772007998 (18)gb:STPORIN2_17228724e-86S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFF034O03Sequence540007998 (18)gb:STPORIN2_17228721e-75S.tuberosum pPOM36II mRNA for 36kDa porinII.738007998 (18)gb:STPORIN2_17228727e-82S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFF051F10Sequence442007998 (18)gb:STPORIN2_17228727e-58S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFN007D20Sequence469007998 (18)gb:STPORIN2_17228723e-42S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFN010L16Sequence616007998 (18)gb:STPORIN2_17228722e-98S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMFS088B11Sequence610007998 (18)gb:STPORIN2_17228721e-90S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMSF049P14Sequence674007998 (18)gb:STPORIN2_17228728e-90S.tuberosum pPOM36II mRNA for 36kDa porinII.751007998 (18)gb:STPORIN2_17228722e-89S.tuberosum pPOM36II mRNA for 36kDa porinII.
JMSF050H11Sequence683007998 (18)gb:STPORIN2_17228724e-90S.tuberosum pPOM36II mRNA for 36kDa porinII.754007998 (18)gb:STPORIN2_17228727e-78S.tuberosum pPOM36II mRNA for 36kDa porinII.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF028F06- GTGAAGAAAACCA
                      ____________________________________________________________
consensus GTGAAGAAAACCA
 
. : . : . : . : . : . :
rJMFF028F06- TGACAATGTTAATCCATTGTGTGACATCTGGATAGATAGATCAAAAAGAATTGGGAAGTT
rJMSF050H11- GTGTGACATCTGGATAGATAGATCAAAAAGAATTGGGAAGTT
rJMFF031B02- TTGGGAAGTT
rJMFF034O03- TTGGGAAGTT
rJMFF033I02- TTGGGAAGTT
                      ____________________________________________________________
consensus TGACAATGTTAATCCATTGTGTGACATCTGGATAGATAGATCAAAAAGAATTGGGAAGTT
 
. : . : . : . : . : . :
rJMFF028F06- CTCACACTGGCATTGACACCAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
rJMSF050H11- CTCACACTGGCATTGACACCAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
rJMFF031B02- CTCACACTGGCATTGACACCAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
rJMFF034O03- CTCACACTGGCATTGACACCAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
rJMFF033I02- CTCACNCTGGCATTGACACCAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
rJMSF049P14- CAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
                      ____________________________________________________________
consensus CTCACACTGGCATTGACACCAGCGAATGAAAGATTATTTTCTACAGTATCATGTACGAAA
 
. : . : . : . : . : . :
JMFN007D20+ CCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
rJMFF028F06- ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
rJMSF050H11- ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
rJMFF031B02- ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
rJMFF034O03- ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
rJMFF033I02- ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
rJMSF049P14- ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
                      ____________________________________________________________
consensus ACCATCATTGCAAGATAAAACTCGGGTTTTTTTCCGGTGAACAAAAAGGTAATTGGAGGA
 
. : . : . : . : . : . :
JMFN007D20+ AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
rJMFF028F06- AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
rJMSF050H11- AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
rJMFF031B02- AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
rJMFF034O03- AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
rJMFF033I02- AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
rJMSF049P14- AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
                      ____________________________________________________________
consensus AGGTTCTACCTAAATTTATTGCTCTGCACCAAACAAAATATCACCATCTCCACTAACTTC
 
. : . : . : . : . : . :
JMFN007D20+ ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
rJMFF028F06- ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
rJMSF050H11- ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
rJMFF031B02- ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
rJMFF034O03- ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
rJMFF033I02- ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
rJMSF049P14- ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
                      ____________________________________________________________
consensus ACCACATGGTAGTGTGCGTAAACTAATCATGGCTTGAGGGCAACAGCCAGCCCAATCTTG
 
. : . : . : . : . : . :
JMFN007D20+ GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
rJMFF028F06- GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
rJMSF050H11- GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
rJMFF031B02- GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
rJMFF034O03- GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
rJMFF033I02- GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
rJMSF049P14- GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
                      ____________________________________________________________
consensus GCACTCTTCTCGATTGCCCTGGTGTCCACTTCACCGGAGATGGTGAAGAGTGATTTTGGA
 
. : . : . : . : . : . :
JMFN007D20+ CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
rJMFF028F06- CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
rJMSF050H11- CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
rJMFF031B02- CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
rJMFF034O03- CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
rJMFF033I02- CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
rJMSF049P14- CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
                      ____________________________________________________________
consensus CGCCACTCATGTTGGATGAGAGCGTGTGCCTTGCCAAAGTTGTTAACCTTGGCCTTCACC
 
. : . : . : . : . : . :
JMFN007D20+ GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTTATTGCTTGAG
rJMFF028F06- GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
rJMSF050H11- GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
rJMFF031B02- GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
rJMFF034O03- GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
rJMFF033I02- GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
rJMSF049P14- GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
JMFN010L16+ TCATTGCTTGAG
                      ____________________________________________________________
consensus GTGGTTGCTGGATCCAATTTGTGTTGTGTCCCAATGGTAAGAGTATTCTCATTGCTTGAG
 
. : . : . : . : . : . :
JMFN007D20+ AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTGATGGTA
rJMFF028F06- AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
rJMSF050H11- AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
rJMFF031B02- AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
rJMFF034O03- AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
rJMFF033I02- AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
rJMSF049P14- AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
JMFN010L16+ AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
JMFS088B11+ CAGTG-TGGTA
JMSF049P14+ GTCGTACAGTG-TGGTA
JMSF050H11+ TGTCAACGGTCGTACAGTG-TGGTA
                      ____________________________________________________________
consensus AAGCTGTGAGTCAACTCCGCACCAACAGCTGTATTTGTCAACGGTCGTACAGTG-TGGTA
 
. : . : . : . : . : . :
JMFN007D20+ GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTA
rJMFF028F06- GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
rJMSF050H11- GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
rJMFF031B02- GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
rJMFF034O03- GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
rJMFF033I02- GTANGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
rJMSF049P14- GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
JMFN010L16+ GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
JMFS088B11+ GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
JMFF008H09+ TTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
JMSF049P14+ GTAGGAAGCACCGAGGAAGTCACCCNTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
JMSF050H11+ GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
                      ____________________________________________________________
consensus GTAGGAAGCACCGAGGAAGTCACCCTTGTCATTCAATGTTAAAGAAGCTATCAAGTCAGA
 
. : . : . : . : . : . :
rJMFF028F06- GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
rJMSF050H11- GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
rJMFF031B02- GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
rJMFF034O03- GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
rJMFF033I02- GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
rJMSF049P14- GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
JMFN010L16+ GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
JMFS088B11+ GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
JMFF034O03+ TTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
JMFF008H09+ GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
JMSF049P14+ GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
JMFF033I02+ ACTTCCCGGTGGCAGTGTCAAATGA
JMFF028F06+ CAGTGTCAAATGA
JMFF031B02+ TGAACTTCCCGGTGGCAGTGTCAAATGA
JMSF050H11+ GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
                      ____________________________________________________________
consensus GGTAGAGAAACTCAATCCAGCATTGTATTTGGTGAACTTCCCGGTGGCAGTGTCAAATGA
 
. : . : . : . : . : . :
rJMFF028F06- GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAG
rJMSF050H11- GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
rJMFF031B02- GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAAGGGG
rJMFF034O03- GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
rJMFF033I02- GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGANAAGCTGACAA-GGG
rJMSF049P14- GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFN010L16+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFS088B11+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFF034O03+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFF008H09+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMSF049P14+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFF033I02+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFF028F06+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFF031B02+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMFF008M07+ AAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
JMSF050H11+ GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
                      ____________________________________________________________
consensus GACATCAGTCCCGAGGGCAAGAGTATTGTTCCCAGCAACACCAGAGAAGCTGACAA-GGG
 
. : . : . : . : . : . :
rJMSF050H11- GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATG
rJMFF031B02- GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGG
rJMFF034O03- GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
rJMFF033I02- GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
rJMSF049P14- GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFN010L16+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFS088B11+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF034O03+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF008H09+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMSF049P14+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF051F10+ GTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF033I02+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF028F06+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF031B02+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMFF008M07+ GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
JMSF050H11+ GACTGGCANTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
                      ____________________________________________________________
consensus GACTGGCAGTTAGTCCAATGCTAGTACTGATTCCAGCATACTCATGCAAGTACTGGAGCT
 
. : . : . : . : . : . :
rJMFF034O03- CTACCTTG
rJMFF033I02- CTACCTTGCCAGATTTCTGGTCTGGAGCAACGANACTAATGATT
rJMSF049P14- CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAG
JMFN010L16+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFS088B11+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF034O03+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF008H09+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMSF049P14+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF051F10+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF033I02+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF028F06+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF031B02+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMFF008M07+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
JMSF050H11+ CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCNGGTG
                      ____________________________________________________________
consensus CTACCTTGCCAGATTTCTGGTCTGGAGCAACGAAACTAATGATTGTCTTCAGCCCTGGTG
 
. : . : . : . : . : . :
JMFN010L16+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFS088B11+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF034O03+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF008H09+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMSF049P14+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF051F10+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF033I02+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF028F06+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF031B02+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMFF008M07+ CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
JMSF050H11+ CTGGTTCATCAACANTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTNTTAGGTCTG
                      ____________________________________________________________
consensus CTGGTTCATCAACAGTGATTGTTGTGTAAAGTTTGGAATTGGTGTCCACTTTTAGGTCTG
 
. : . : . : . : . : . :
JMFN010L16+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFS088B11+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF034O03+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF008H09+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTCCT
JMSF049P14+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF051F10+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF033I02+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF028F06+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF031B02+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMFF008M07+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
JMSF050H11+ TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
                      ____________________________________________________________
consensus TTGTGATATTTTTATTCTTCAGCTGTGTGTTGACATCAGCTACAAGTAATTCGCCTTTCT
 
. : . : . : . : . : . :
JMFN010L16+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFS088B11+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF034O03+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF008H09+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMSF049P14+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF051F10+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF033I02+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF028F06+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF031B02+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMFF008M07+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
JMSF050H11+ TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
                      ____________________________________________________________
consensus TAACACCAGACGAAGTAATGGCCACTCCGGTGGCGGAGTAAGTGGTGATGGTAAACTTGT
 
. : . : . : . : . : . :
JMFN010L16+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFS088B11+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF034O03+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF008H09+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMSF049P14+ GGTCGGCGACGTAGTCCCNGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF051F10+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF033I02+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF028F06+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF031B02+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMFF008M07+ GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
JMSF050H11+ GGTCGGCGACGTAGTCCCNGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
                      ____________________________________________________________
consensus GGTCGGCGACGTAGTCCCTGTAGAGAAGATCTTTGGCTTTTTTGCCGATGTCGGAGTAGA
 
. : . : . : . : . : . :
JMFN010L16+ GACCGG
JMFS088B11+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF034O03+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF008H09+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMSF049P14+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF051F10+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF033I02+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF028F06+ GACCGGGACCCTTCACCATCTCGCCTACTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF031B02+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMFF008M07+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
JMSF050H11+ GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
                      ____________________________________________________________
consensus GACCGGGACCCTTCACCATCTCGCCTTCTGGCAGTTAACACCGGAGCTGTAGAGAGAGAA
 
. : . : . : . : . : . :
JMFS088B11+ G
JMFF034O03+ GCGACGGAGGAGAAAAGTTCT
JMFF008H09+ GCGACGGAGGAGAAAAGTTCTTCGATTCT
JMSF049P14+ GCGACGGAGGAGAAAAGTTCTTCGATTCTAGAGAGAGAGAGAGAGAGAGAGGGGAGGC
JMFF051F10+ GCGACGGAGGAGAAAAGTTCTTCGATTCTA
JMFF033I02+ GCGACGGAGGAGAAAAGTTCTTCGATTCTA
JMFF028F06+ GCGACGGAGGAGAAAAGTTCTTCGATTC
JMFF031B02+ GCGACGGAGGAGAAAAGTTCTTCGATTCT
JMFF008M07+ GCGACGGAGGAGAAAAGTTCTTCGATTCT
JMSF050H11+ GCGACGGAGGAGAAAAGTTCTTCGATTCTAGAGAGAGAGAGAGAGAGAGAGGGGAGGCTC
                      ____________________________________________________________
consensus GCGACGGAGGAGAAAAGTTCTTCGATTCTAGAGAGAGAGAGAGAGAGAGAGGGGAGGCTC