Previous Contig 007994:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017K21Sequence273007994 (3)746022779gb:AP000600_18203713e-53Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MAG2.
JMSF050G13Sequence694007994 (3)660007994 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050G13+ CAATACTAAAAATACGTCGACTTGGCCTTTCACC
                      ____________________________________________________________
consensus CAATACTAAAAATACGTCGACTTGGCCTTTCACC
 
. : . : . : . : . : . :
rJMSF050G13- CCTAACAATTCCTAGTAACTAATTGCTGGACTTGACCCTTCACGGGGCTAAC
JMSF050G13+ CGCCTTCACCTAACAATTCCTAGTAACTAATTGCTGGACTTGACCCTTCACGGGGCTAAC
                      ____________________________________________________________
consensus CGCCTTCACCTAACAATTCCTAGTAACTAATTGCTGGACTTGACCCTTCACGGGGCTAAC
 
. : . : . : . : . : . :
rJMSF050G13- CCAAAACTACTGGCTGAACCTAAGCTGAATATAACCAACGATGAATCAAAATTGAACCAA
JMSF050G13+ CCAAAACTACTGGCTGAACCTAAGCTGAATATAACCAACGATGAATCAAAATTGAACCAA
                      ____________________________________________________________
consensus CCAAAACTACTGGCTGAACCTAAGCTGAATATAACCAACGATGAATCAAAATTGAACCAA
 
. : . : . : . : . : . :
rJMSF050G13- CCACATACTCAGCACCGCAATGTCTAATTCAAATCTCAACTCGCACTTAGCTACAAAACA
JMSF050G13+ CCACATACTCAGCACCGCAATGTCTAATTCAAATCTCAACTCGCACTTAGCTACAAAACA
                      ____________________________________________________________
consensus CCACATACTCAGCACCGCAATGTCTAATTCAAATCTCAACTCGCACTTAGCTACAAAACA
 
. : . : . : . : . : . :
rJMSF050G13- AACCAAAGAAAAGGGGGCAGAAGCAATTTTGCAAGAGAACCATGAACTACCCCAAATCGT
JMSF050G13+ AACCAAAGAAAAGGGGGCAGAAGCAATTTTGCAAGAGAACCATGAACTACCCCAAATCGT
                      ____________________________________________________________
consensus AACCAAAGAAAAGGGGGCAGAAGCAATTTTGCAAGAGAACCATGAACTACCCCAAATCGT
 
. : . : . : . : . : . :
rJMSF050G13- TATGAACTCGAAACTCCGTACCTTGAAATGAATGGGCAGCCATTGAGAAGACTTATTGGG
JMSF050G13+ TATGAACTCGAAACTCCGTACCTTGAAATGAATGGGCAGCCATTGAGAAGACTTATTGGG
                      ____________________________________________________________
consensus TATGAACTCGAAACTCCGTACCTTGAAATGAATGGGCAGCCATTGAGAAGACTTATTGGG
 
. : . : . : . : . : . :
rJMSF050G13- GGTTTTGTTGATAAGGGTCTCCTCAACAAGTAGTCGTATCTGGCGTCCGAGTTGTCTGTT
JMSF050G13+ GGTTTTGTTGATAAGGGTCTCCTCAACAAGTAGTCGTATCTGGCGTCCGAGTTGTCTGTT
                      ____________________________________________________________
consensus GGTTTTGTTGATAAGGGTCTCCTCAACAAGTAGTCGTATCTGGCGTCCGAGTTGTCTGTT
 
. : . : . : . : . : . :
JMSF017K21+ AGAAAATGGGTTTAAGAGTGTGGGTTTTGGGAGG
rJMSF050G13- GTGCTTGAATGGCTGGAGAGTTGCCAAGAAAATGGGTTTAAGAGTGTGGGTTTTGGGAGG
JMSF050G13+ GTGCTTGAATGGCTGGAGAGTTGCCAAGAAAATGGGTTTAAGAGTGTGGGTTTTGGGAGG
                      ____________________________________________________________
consensus GTGCTTGAATGGCTGGAGAGTTGCCAAGAAAATGGGTTTAAGAGTGTGGGTTTTGGGAGG
 
. : . : . : . : . : . :
JMSF017K21+ GCAGGAATTCCATGGCAGAAGGCCTTGCTTCATCATCATCTTCTAATTCTTCTTCTTCTC
rJMSF050G13- GCAGGAATTCCATGGCAGAAGGCCTTGCTTCATCATCATCTTCTAATTCTTCTTCTTCTC
JMSF050G13+ GCAGGAATTCCATGGCAGAAGGCCTTGCTTCATCATCATCTTCTAATTCTTCTTCTTCTC
                      ____________________________________________________________
consensus GCAGGAATTCCATGGCAGAAGGCCTTGCTTCATCATCATCTTCTAATTCTTCTTCTTCTC
 
. : . : . : . : . : . :
JMSF017K21+ CACTGCTTAGTCTATAATAGAATCTTGATTCCTTTTCCTATCTAGTTCCTGATAACGGAA
rJMSF050G13- CACTGCTTAGTCTATAATAGAATCTTGATTCCTTTTCCTATCTAGTTCCTGATAACGGAA
JMSF050G13+ CACTGCTTAGTCTATAATAGAATCTTGATTCCTTTTCCTATCTAGTTCCTGATAACGGAA
                      ____________________________________________________________
consensus CACTGCTTAGTCTATAATAGAATCTTGATTCCTTTTCCTATCTAGTTCCTGATAACGGAA
 
. : . : . : . : . : . :
JMSF017K21+ GGAAAATCACCAAAAATTTAACGTAGTATTCTTCAAGTACAGTACAGTGGCGTTCCGGCT
rJMSF050G13- GGAAAATCACCAAAAATTTAACGTAGTATTCTTCAAGTACAGTACAGTGGCGTTCCGGCT
JMSF050G13+ GGAAAATCACCAAAAATTTAACGTAGTATTCTTCAAGTACAGTACAGTGGCGTTCCGGCT
                      ____________________________________________________________
consensus GGAAAATCACCAAAAATTTAACGTAGTATTCTTCAAGTACAGTACAGTGGCGTTCCGGCT
 
. : . : . : . : . : . :
JMSF017K21+ CTGTGCCCATTGACCAACGCCCATTGCCATTTGATTTGGGTTCCTAATTCCTATCTTCC
rJMSF050G13- CTGTGCCCATTGACCAACGCCCATTGCCATTTGATTTGGGTTCCTAATTCCTATCTTCC
JMSF050G13+ CTGTGCCCATTGACCAACGCCCATTGCCATTTGATTTGGGTTCCTAATTCCTATCTTCCT
                      ____________________________________________________________
consensus CTGTGCCCATTGACCAACGCCCATTGCCATTTGATTTGGGTTCCTAATTCCTATCTTCCT