Previous Contig 007991:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004P11Sequence609007991 (15)gb:AY563049_16150071e-98Nicotiana sylvestris RAN (ran) mRNA, complete cds.>gb:AY563050_1615008 Nicotiana782007991 (15)gb:AF495716_18055477e-91Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMFN004H12Sequence657007991 (15)gb:AF495716_1805547e-118Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF016G08Sequence242007991 (15)gb:AF495716_18055476e-27Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.775007991 (15)gb:AF495716_1805547e-105Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF017G08Sequence120007991 (15)
JMSF021D08Sequence705007991 (15)gb:AF495716_1805547e-120Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.751007991 (15)gb:AF495716_18055477e-94Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF026M06Sequence671007991 (15)gb:AF495716_1805547e-117Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.701007991 (15)gb:AF495716_18055472e-82Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF030O02Sequence650007991 (15)gb:AF495716_1805547e-113Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.747007991 (15)gb:AF495716_18055477e-94Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF035E17Sequence402006679 (9)739007991 (15)gb:AF495716_18055473e-90Helianthus annuus GTP-binding protein (RAN) mRNA, complete cds.
JMSF050G03Sequence203007991 (15)151007991 (15)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF016G08- GAAGACAATCATTCTGCTCTCT
JMSF030O02- AAGACAATCATTCTGCTCTCT
JMFF004P11- AAGACAATCATTCTGCTCTCT
JMSF026M06- AAGACAATCATTCTGCTCTCT
JMSF021D08- AGACAATCATTCTGCTCTCT
                      ____________________________________________________________
consensus GAAGACAATCATTCTGCTCTCT
 
. : . : . : . : . : . :
JMSF016G08- CTATAGCCTCCGTCTCTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
JMSF030O02- CTATAGCCTCCGTCTCTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
JMFF004P11- CTATAGCCTCCGTCTCTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
JMSF026M06- CTATAGCCTCCGTCTCTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
JMFN004H12- CTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
JMSF021D08- CTATAGCCTCCGTCTCTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
                      ____________________________________________________________
consensus CTATAGCCTCCGTCTCTTGCTCTCTCGCTCTAACCAAGCAACGACGCTATGGCACTTCCA
 
. : . : . : . : . : . :
JMSF016G08- AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTGGTGATGGTGGAACT
JMSF030O02- AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTGGTGATGGTGGAACT
JMFF004P11- AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTGGTGATGGTGGAACT
JMSF026M06- AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTGGTGATGGTGGAACT
JMFN004H12- AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTCGTGATGGTGGAACT
JMSF021D08- AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTGGTGATGGTGGAACT
                      ____________________________________________________________
consensus AATCAGCAGACAGTTGATTACCCAAGCTTTAAGCTTGTAATTGTTGGTGATGGTGGAACT
 
. : . : . : . : . : . :
JMSF016G08- GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
JMSF030O02- GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
JMFF004P11- GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
JMSF026M06- GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
JMFN004H12- GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
JMSF021D08- GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
rJMSF016G08+ CGAGAAGAAATATGAACCC
                      ____________________________________________________________
consensus GGAAAAACTACATTTGTGAAGAGGCACATTACTGGTGAATTCGAGAAGAAATATGAACCC
 
. : . : . : . : . : . :
JMSF016G08- ACCATAGGTGTGGAGGTGCATCCNTTGGATTTCTTCACAA
JMSF030O02- ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
JMFF004P11- ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
JMSF026M06- ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
JMFN004H12- ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
JMSF021D08- ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
rJMSF016G08+ ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
rJMSF030O02+ TCACAAATTGTGGAAAAATCAGATTT
rJMSF021D08+ TCACAAATTGTGGAAAAATCAGATTT
rJMSF035E17+ AATCAGATTT
rJMFF004P11+ AAAAATCAGATTT
                      ____________________________________________________________
consensus ACCATAGGTGTGGAGGTGCATCCATTGGATTTCTTCACAAATTGTGGAAAAATCAGATTT
 
. : . : . : . : . : . :
JMSF030O02- TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
JMFF004P11- TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
JMSF026M06- TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
JMFN004H12- TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
JMSF021D08- TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
rJMSF016G08+ TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
rJMSF030O02+ TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
rJMSF021D08+ TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
rJMSF035E17+ TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
rJMSF026M06+ AAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
rJMFF004P11+ TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
                      ____________________________________________________________
consensus TATTGTTGGGATACTGCTGGCCAAGAAAAATTTGGTGGTCTTAGGGATGGTTACTATATT
 
. : . : . : . : . : . :
JMSF030O02- CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
JMFF004P11- CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
JMSF026M06- CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
JMFN004H12- CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
JMSF021D08- CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
rJMSF016G08+ CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
rJMSF030O02+ CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
rJMSF021D08+ CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
rJMSF035E17+ CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
rJMSF026M06+ CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
rJMFF004P11+ CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
                      ____________________________________________________________
consensus CACGGACAATGTGCTATTATCATGTTTGATGTAACTGCTAGATTGACATACAAAAATGTG
 
. : . : . : . : . : . :
JMSF030O02- CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
JMFF004P11- CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
JMSF026M06- CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
JMFN004H12- CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
JMSF021D08- CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
rJMSF016G08+ CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
rJMSF030O02+ CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
rJMSF021D08+ CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
rJMSF035E17+ CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
rJMSF026M06+ CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
rJMFF004P11+ CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
                      ____________________________________________________________
consensus CCCACATGGCACCGTGATCTTTGCCGTGTTTGTGAAAACATTCCCATTGTTCTTTGCGGG
 
. : . : . : . : . : . :
JMSF030O02- AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
JMFF004P11- AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
JMSF026M06- AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
JMFN004H12- AACAAGGTTGATGAGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
JMSF021D08- AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
rJMSF016G08+ AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
rJMSF030O02+ AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
rJMSF021D08+ AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
rJMSF035E17+ AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
rJMSF026M06+ AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
rJMFF004P11+ AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
                      ____________________________________________________________
consensus AACAAGGTTGATGTGAAGAACAGGCAAGTTAAGGCCAAGCAGGTTACCTTTCATCGGAAG
 
. : . : . : . : . : . :
JMSF030O02- AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
JMFF004P11- AANAATTTGCAGTATTACNAAATATCTGCAAAGAGTAATTACAACTTTGANAANCCTTTC
JMSF026M06- AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
JMFN004H12- AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
JMSF021D08- AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
rJMSF016G08+ AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
rJMSF030O02+ AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
rJMSF021D08+ AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
rJMSF035E17+ AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
rJMSF026M06+ AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
rJMFF004P11+ AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
                      ____________________________________________________________
consensus AAGAATTTGCAGTATTACGAAATATCTGCAAAGAGTAATTACAACTTTGAGAAGCCTTTC
 
. : . : . : . : . : . :
JMSF030O02- CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
JMFF004P11- CTCTACCTCGCCAGGAAACTTGCTGGGGGATCCNAACTTGCACTTTGT
JMSF026M06- CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
JMFN004H12- CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
JMSF021D08- CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
rJMSF016G08+ CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
rJMSF030O02+ CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
rJMSF021D08+ CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
rJMSF035E17+ CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
rJMSF026M06+ CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
rJMFF004P11+ CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
                      ____________________________________________________________
consensus CTCTACCTCGCCAGGAAACTTGCT-GGGGATCCGAACTTGCACTTTGTTGAGTCGCCCGC
 
. : . : . : . : . : . :
JMSF030O02- ACTTGCTCCTCCAGAAGTACAAATTGACT
JMSF026M06- ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACG
JMFN004H12- ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
JMSF021D08- ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
rJMSF016G08+ ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
rJMSF030O02+ ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
rJMSF021D08+ ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
rJMSF035E17+ ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
rJMSF026M06+ ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
rJMFF004P11+ ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
                      ____________________________________________________________
consensus ACTTGCTCCTCCAGAAGTACAAATTGACTTAGCTGCACAACAGCAGCACGAGGCTGAGCT
 
. : . : . : . : . : . :
JMFN004H12- AATTGCTGCTGC
JMSF021D08- AATTGCTGCTGCA
rJMSF016G08+ AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
rJMSF030O02+ AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
rJMSF021D08+ AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
rJMSF035E17+ AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
rJMSF026M06+ AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
rJMFF004P11+ AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
                      ____________________________________________________________
consensus AATTGCTGCTGCAAGCCAACCTCTACCAGATGACGATGATGACACCTTTGAGTAAATCCA
 
. : . : . : . : . : . :
rJMSF016G08+ TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
rJMSF030O02+ TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
rJMSF021D08+ TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
rJMSF035E17+ TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
rJMSF026M06+ TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
rJMSF017G08+ TCATATTTTNGTAGCAGAAAAGCAGCTTTTATTTTG
rJMFF004P11+ TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
                      ____________________________________________________________
consensus TCCATTGGCCGATTGGAATGCACTTCATATTTTAGTAGCAGAAAAGCAGCTTTTATTTTG
 
. : . : . : . : . : . :
rJMSF016G08+ TGTTGGGTGTCACCATTTTTTTCAAGTGGGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
rJMSF030O02+ TGTTGGGTGTCACCATTTTTTTCAAGTGGGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
rJMSF021D08+ TGTTGGGTGTCACCATTTTTTTCAAGTGGGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
rJMSF035E17+ TGTTGGGTGTCACCATTTTTTTCAAGTGGGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
rJMSF050G03+ GTGCTTATGAGT-ACGTAAGGGAAAAT
rJMSF026M06+ TGTTGGGTGTCACCATTTTTTTCAAGT-GGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
rJMSF017G08+ TNTTGGGTGTCNCCNTTTTTTTCAAGTGGGAAGGTGCTTATGAGTCACGTAAGGGANAAT
rJMFF004P11+ TGTTGGGTGTCACCATTTTTTTCAAGTGGGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
JMSF050G03- GTGCTTATGAGT-ACGTAAGGGAAAAT
                      ____________________________________________________________
consensus TGTTGGGTGTCACCATTTTTTTCAAGTGGGAAGGTGCTTATGAGT-ACGTAAGGGAAAAT
 
. : . : . : . : . : . :
rJMSF016G08+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
rJMSF030O02+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
rJMSF021D08+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
rJMSF035E17+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
rJMSF050G03+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
rJMSF026M06+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
rJMSF017G08+ ATGAATGATTGATGA
rJMFF004P11+ ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
JMSF050G03- ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
                      ____________________________________________________________
consensus ATGAATGATTGATGATGGTCTTTATGAGATGTTGAACTAATTTTGGGTATTTTTTTACCT
 
. : . : . : . : . : . :
rJMSF016G08+ GATTTGTTGTGGGGAAGTA-TTGAAGCCATATAAATT-CA
rJMSF030O02+ GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATT-CATGTCCTT-CCTATTGA-GTG
rJMSF021D08+ GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATT-CATGTCCTT-CCTATTGA-GTG
rJMSF035E17+ GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATTCCATGTCCTT-CCTATTGAGGTG
rJMSF050G03+ GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATTCCATGTCCTTCCCTATTGA-GTG
rJMSF026M06+ GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATT-CATGTCCTTCCCTATTGA-GTG
rJMFF004P11+ GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATT-CATGTCCTT-CCTATTGA-GTG
JMSF050G03- GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATT-CATGTCCTT-CCTATTGA-GTG
                      ____________________________________________________________
consensus GATTTGTTGTGGGGAAGTATTTGAAGCCATATAAATT-CATGTCCTT-CCTATTGA-GTG
 
. : . : . : . : . : . :
rJMSF030O02+ TGGATC
rJMSF021D08+ TGGATCTATG
rJMSF035E17+ TGGATCTATG
rJMSF050G03+ TGGATC
rJMSF026M06+ TGGATCTA
rJMFF004P11+ TGGATCTATGTATTAATGGATCA-TTGAAATGAAAGGTGTTTTTAATATCA
JMSF050G03- TGGATCTATGTATTAATGGATCATTTGAAATGAAAGGTGTTTTTAATATCAAAAAAAAAA
                      ____________________________________________________________
consensus TGGATCTATGTATTAATGGATCATTTGAAATGAAAGGTGTTTTTAATATCAAAAAAAAAA