Previous Contig 007985:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF022H12Sequence597007985 (2)810023030
JMSF050E18Sequence637007985 (2)750024413gb:AB020746_15146112e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MOB24.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022H12+ ACACGAAACTCTCCTCCTCACTCCACGCCCCCCTCGAGCTCCCTCCACCT
JMSF050E18+ CTCCTCACTCCACGCCCCCCTCGAGCTCCCTCCACCT
                      ____________________________________________________________
consensus ACACGAAACTCTCCTCCTCACTCCACGCCCCCCTCGAGCTCCCTCCACCT
 
. : . : . : . : . : . :
JMSF022H12+ CGCGTAGTTCCTTGTAAATTTCCCACGGC-ACGAGGGGCAAACTCGTAATTTGACGCTAA
JMSF050E18+ CGCGTAGTTCCTTGTAAATTTCCCACGGCAACGAGGGGCAAACTCGTAATTTGACGCTAA
                      ____________________________________________________________
consensus CGCGTAGTTCCTTGTAAATTTCCCACGGCAACGAGGGGCAAACTCGTAATTTGACGCTAA
 
. : . : . : . : . : . :
JMSF022H12+ AGACTCCATCTTTCTTTTCTTCTTGTTCCTGAAATCATACCCATTCTCAGCCCCCCCGTT
JMSF050E18+ AGACTCCATCTTTCTTTTCTTCTTGTTCCTGAAATCATACCCATTCTCAGCCCCCCCGTT
                      ____________________________________________________________
consensus AGACTCCATCTTTCTTTTCTTCTTGTTCCTGAAATCATACCCATTCTCAGCCCCCCCGTT
 
. : . : . : . : . : . :
JMSF022H12+ GAATTCCGGATCATCTTCTCCTTCATCAGACTCTTCAGTATCATCGTATTCATATTCGTT
JMSF050E18+ GAATTCCGGATCATCTTCTCCTTCATCAGACTCTTCAGTATCATCGTATTCATATTCGTT
                      ____________________________________________________________
consensus GAATTCCGGATCATCTTCTCCTTCATCAGACTCTTCAGTATCATCGTATTCATATTCGTT
 
. : . : . : . : . : . :
JMSF022H12+ CTTGTATCTACTATAATGGGTGTCTTTAGGATAAGAGCTAGGGTTCCTAATTGGGCGTCT
JMSF050E18+ CTTGTATCTACTATAATGGGTGTCTTTAGGATAAGAGCTAGGGTTCCTAATTGGGCGTCT
                      ____________________________________________________________
consensus CTTGTATCTACTATAATGGGTGTCTTTAGGATAAGAGCTAGGGTTCCTAATTGGGCGTCT
 
. : . : . : . : . : . :
JMSF022H12+ CGATCGAGAAGAAAAGCTGTAAACAGAAGTGGGTTTTTGTGAGTACCTTCCTTCATCATC
JMSF050E18+ CGATCGAGAAGAAAAGCTGTAAACAGAAGTGGGTTTTTGTGAGTACCTTCCTTCATCATC
                      ____________________________________________________________
consensus CGATCGAGAAGAAAAGCTGTAAACAGAAGTGGGTTTTTGTGAGTACCTTCCTTCATCATC
 
. : . : . : . : . : . :
JMSF022H12+ AGAATCATCCATATCTTCGGAATATCTTCTCCCCGCCAGCTCGAACCTCTTTCTTTATAT
JMSF050E18+ AGAATCATCCATATCTTCGGAATATCTTCTCCCCGCCAGCTCGAACCTCTTTCTTTATAT
                      ____________________________________________________________
consensus AGAATCATCCATATCTTCGGAATATCTTCTCCCCGCCAGCTCGAACCTCTTTCTTTATAT
 
. : . : . : . : . : . :
JMSF022H12+ CTATATAAATAAATTGGGTTTTTTCCCCCCTTATTCTTGACAGAAAATTGGAGAACTTTA
JMSF050E18+ CTATATAAATAAATTGGGTTTTTTCCCCCCTTATTCTTGACAGAAAATTGGAGAACTTTA
                      ____________________________________________________________
consensus CTATATAAATAAATTGGGTTTTTTCCCCCCTTATTCTTGACAGAAAATTGGAGAACTTTA
 
. : . : . : . : . : . :
JMSF022H12+ TTGTTGAAAACCAAAATTAGAGGCGAAATTGATATGGGTTTGAAGGAAACTTCAAAATAA
JMSF050E18+ TTGTTGAAAACCAAAATTAGAGGCGAAATTGATATGGGTTTGAAGGAAACTTCAAAATAA
                      ____________________________________________________________
consensus TTGTTGAAAACCAAAATTAGAGGCGAAATTGATATGGGTTTGAAGGAAACTTCAAAATAA
 
. : . : . : . : . : . :
JMSF022H12+ GAAAGGGAAAAATGAAAGGAATTACAGACCTTGGAGCTCTGATCTCGGAGATTAGGGTTT
JMSF050E18+ GAAAGGGAAAAATGAAAGGAATTACAGACCTTGGAGCTCTGATCTCGGAGATTAGGGTTT
                      ____________________________________________________________
consensus GAAAGGGAAAAATGAAAGGAATTACAGACCTTGGAGCTCTGATCTCGGAGATTAGGGTTT
 
. : . : . : . : . : . :
JMSF022H12+ TGATAGT
JMSF050E18+ TGATAGTGGAAGAAAAGAGGGGAGATTGGGAACTGAGGTGTCAAAGAGTTCTCAGAGATC
                      ____________________________________________________________
consensus TGATAGTGGAAGAAAAGAGGGGAGATTGGGAACTGAGGTGTCAAAGAGTTCTCAGAGATC