Previous Contig 007979:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010A05Sequence541007979 (9)pir|T00696|T006961e-49probable methylenetetrahydrofolate reductase [imported] - Arabidopsis thaliana722008628 (6)gb:AF370515_17923001e-67Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMFF021O18Sequence403007979 (9)gb:AF174486_17744791e-49Zea mays methylenetetrahydrofolate reductase mRNA, complete cds.583009237 (2)gb:AC139172_17440223e-46Oryza sativa chromosome 3 BAC OSJNBb0042K11 genomic sequence, complete sequence.
JMFF028D20Sequence559007979 (9)pir|T47821|T478212e-75methylenetetrahydrofolate reductase MTHFR1 - Arabidopsis thaliana>gb:ATF24G16_15645009237 (2)gb:AC139172_17440225e-59Oryza sativa chromosome 3 BAC OSJNBb0042K11 genomic sequence, complete sequence.
JMFF036C04Sequence487007979 (9)pir|T00696|T006966e-54probable methylenetetrahydrofolate reductase [imported] - Arabidopsis thaliana769008628 (6)gb:AF370515_17923005e-76Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMFF042B02Sequence653007979 (9)sp|O80585|MTHR_ARATH2e-79Methylenetetrahydrofolate reductase (EC 1.5.1.20) (MTHFR2).>gb:AC004005_1531327
JMSF040N21Sequence644007979 (9)sp|O80585|MTHR_ARATH4e-81Methylenetetrahydrofolate reductase (EC 1.5.1.20) (MTHFR2).>gb:AC004005_1531327 858008628 (6)gb:AF370515_17923001e-83Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMSF048E15Sequence700007979 (9)sp|O80585|MTHR_ARATH2e-80Methylenetetrahydrofolate reductase (EC 1.5.1.20) (MTHFR2).>gb:AC004005_1531327 782008628 (6)gb:AF174486_17744793e-80Zea mays methylenetetrahydrofolate reductase mRNA, complete cds.
JMSF050D05Sequence301007979 (9)gb:AF370515_17923000.005Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6754008628 (6)gb:AF370515_17923003e-72Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMSF050L23Sequence134007979 (9)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF028D20+ CAG
JMSF040N21+ CAG
                      ____________________________________________________________
consensus CAG
 
. : . : . : . : . : . :
JMFF028D20+ CTGTAGCCACCCCACTAGCAGGTATAACATCAGGATGTGCCTCTGGATAACCGGCAACCG
JMSF040N21+ CTGTAGCCACTCCACTAGCAGGTATTACATCAGGATGTGCCTCTGGATAACCGGCAACCG
JMFF042B02+ ACATCAGGATGTGCCTCTGGATAACCGGCAACCG
JMSF048E15+ CCACTAGCAGGTATTACATCAGGATGTGCCTCTGGATAACCGGCAACCG
                      ____________________________________________________________
consensus CTGTAGCCACTCCACTAGCAGGTATTACATCAGGATGTGCCTCTGGATAACCGGCAACCG
 
. : . : . : . : . : . :
JMFF028D20+ TGATCCCGAAGTAGTCCCCGTATTTTTCACGCATGTGCTTCACGAGGTCCAAGGCGCAGG
JMSF040N21+ TGATCCCGAAGTAGTCCCCGTACTTTTCACGCATGTGCTTCACGAGGTCCAAGGCGCAGG
JMFF042B02+ TGATCCCGAAGTAGTCNCCGTACTTNTCACGCATGTGCTTCACGAGGTCCAAGGCGCAGG
JMSF048E15+ TGATCCCGAAGTAGTCCCCGTACTTTTCACGCATGTGCTTCACGAGGTCCAAGGCGCAGG
                      ____________________________________________________________
consensus TGATCCCGAAGTAGTCCCCGTACTTTTCACGCATGTGCTTCACGAGGTCCAAGGCGCAGG
 
. : . : . : . : . : . :
JMFF028D20+ AGAAGCCGCCTTCGACGGGGACGAACTTGTCCTGGCCGCGAGGAGGGTCACCGCGGAGGG
JMFF021O18+ GGCCGCGAGGAGGGTCACCGCGGAGGG
JMSF040N21+ AGAAGCCACCTTCGACCTGGACGAACTTGTCCTGGCCGTGAGGCGGGTCACCGCGGAGAG
JMFF010A05+ CCTGGACGAACTTGTCCTGGCCGTGAGGCGGGTCACCGCGGAGAG
JMFF036C04+ CGTGAGGCGGGTCACCGCGGAGAG
JMFF042B02+ AGAAGCCACCTTCGACCTGGACGAACTTGTCCTGGCCGTGAGGCGGGTCACCGCGGAGAG
JMSF048E15+ AGAAGCCACCTTCGACCTGGACGAACTTGTCCTGGCCGTGAGGCGGGTCACCGCGGAGAG
                      ____________________________________________________________
consensus AGAAGCCACCTTCGACCTGGACGAACTTGTCCTGGCCGTGAGGCGGGTCACCGCGGAGAG
 
. : . : . : . : . : . :
JMFF028D20+ CGAGGACGTTTTGGACGCCGTTAGACTTGATGGTATCCAGAGCGTGGTCGATCTTCTCAA
JMFF021O18+ CGAGGACGTTTTGGACGCCGTTAGACTTGATGGTATCCAGAGCGTGGTCGATCTTCTCAA
JMSF040N21+ CGAGGACGTTTTGGATGCCGTTAGACTTGATGGTGTCCAGAGCGTGGTCGATCTTCTCAA
JMFF010A05+ CGAGGACGTTTTGGATGCCGTTAGACTTGATGGTGTCCAGAGCGTGGTCGATCTTCTCAA
JMFF036C04+ CGAGGACGTTTTGGATGCCGTTAGACTTGATGGTGTCCAGAGCGTGGTCGATCTTCTCAA
JMFF042B02+ CGAGGACGTTTTGGATGCCGTTAGACTTGATGGTGTCCAGAGCGTGGTCGATCTTCTCAA
JMSF048E15+ CGAGGACGTTTTGGATGCCGTTAGACTTGATGGTGTCCAGAGCGTGGTCGATCTTCTCAA
                      ____________________________________________________________
consensus CGAGGACGTTTTGGATGCCGTTAGACTTGATGGTGTCCAGAGCGTGGTCGATCTTCTCAA
 
. : . : . : . : . : . :
JMFF028D20+ CGGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCACACCTTATTCTGCATGC
JMFF021O18+ CGGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCACACCTTATTCTGCATGC
JMSF040N21+ CAGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCAGACCATATTCTGCATGC
JMFF010A05+ CAGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCAGACCATATTCTGCATGC
JMFF036C04+ CAGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCAGACCATATTCTGCATGC
JMFF042B02+ CAGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCAGACCATATTCTGCATGC
JMSF048E15+ CAGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCAGACCATATTCTGCATGC
                      ____________________________________________________________
consensus CAGGCATGTTGGTGCAGGTGAGATGCATCATGGTCTCAACGCAGACCATATTCTGCATGC
 
. : . : . : . : . : . :
JMFF028D20+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCACGTGATATCG
JMFF021O18+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCACGTGATATCG
JMSF040N21+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCAGGTGATATCG
JMFF010A05+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCGCCCCCAGGTGATATCG
JMFF036C04+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCAGGTGATATCG
JMFF042B02+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCAGGTGATATCG
JMSF048E15+ GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCAGGTGATATCG
                      ____________________________________________________________
consensus GGTTGGCGATGTCGAGGGTGAGATCGGCGGTGGAGCCGCCGGCG-CCCCAGGTGATATCG
 
. : . : . : . : . : . :
JMFF028D20+ CAGAAGGTGGGGTTATGAGCCACCATGCGCTCCATCCGCTCGAAAAAGTTCTCAACTACT
JMFF021O18+ CAGAAGGTGGGGTTATGAGCCACCATGCGCTCCATCCGCTCGAAAAAGTTCTCAACTACT
JMSF040N21+ CAGAAGGTGGGGTTATGAGCCACCATTCGGTCCATTCGCTCGAACAAGTTCTCAACTCCG
JMFF010A05+ CAGAAGGTGGGGTTATGAGCCACCATTCGGTCCATTCGCTCGAACAAGTTCTCAACTCCG
JMFF036C04+ CAGAAGGTGGGGTTATGAGCCACCATTCGGTCCATTCGCTCGAACAAGTTCTCAACTCCG
JMFF042B02+ CAGAAGGTGGGGTTATGAGCCACCATTCGGTCCATTCGCTCGAACAAGTTCTCAACTCCG
JMSF048E15+ CAGAAGGTGGGGTTATGAGCCACCATTCGGTCCATTCGCTCGAACAAGTTCTCAACTCCG
JMSF050D05+ G
                      ____________________________________________________________
consensus CAGAAGGTGGGGTTATGAGCCACCATTCGGTCCATTCGCTCGAACAAGTTCTCAACTCCG
 
. : . : . : . : . : . :
JMFF028D20+ TCCTGCTTCCTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATTGTTCTCC
JMFF021O18+ TCCTGCTTCCTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATTGTTCTCC
JMSF040N21+ TCCTCCGTCTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
JMFF010A05+ TCCTCCGTCTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
JMFF036C04+ TCCTCCGTCTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
JMFF042B02+ TCCTCCGTCTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
JMSF048E15+ TCCTCCGTCTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
JMSF050D05+ TCCTCCGTNTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
                      ____________________________________________________________
consensus TCCTCCGTCTTCGGAGGGAAGAACTCGAAGGAGAACACCACCTTATTGCCATCGTTCTCC
 
. : . : . : . : . : . :
JMFF028D20+ TTGGACACCTCCCGGATCTTGTCTATCACCTTCATATCTGCTCTTTCTCT
JMFF021O18+ TTGGACACCTCCCGGATCTTGTCTATCACCTTCATATCTGCTCTTTCTCT
JMSF040N21+ TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
JMSF050L23+ TCACCTTCATAACTGCTCTTCCTCTTTCACTCTAG
JMFF010A05+ TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
JMFF036C04+ TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
JMFF042B02+ TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
JMSF048E15+ TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
JMSF050D05+ TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
                      ____________________________________________________________
consensus TTGGACAACTCCCGGATCTTGTCTATCACCTTCATAACTGCTCTTCCTCTTTCACTCTCG
 
. : . : . : . : . : . :
JMSF040N21+ TAGATCTGCTCAACTCGCAATGCAGATTCCAAGCTCGCGTCTAGGGATTCGAAATGGAAT
JMSF050L23+ TAGCTCTGCTCAACTCGCAATGCAGATTCCAANCTCGNGTNTAGGGATTNGAAATGGAAT
JMFF010A05+ TAGCTCTGCTCAACTCGCAATGCAGATTCCAAGCTCGCGTCTAGGGATTCGAAATGGAAT
JMFF036C04+ TAGCTCTGCTCAACTCGCAATGCAGATTCCAAGCTCGCGTCTAGGGATTCGAAATGGAAT
JMFF042B02+ TAGCTCTGCTCAACTCGCAATGCAGATTCCAAGCTCGCGTCTAGGGATTCGAAATGGAAT
JMSF048E15+ TAGCTCTGCTCAACTCGCAATGCAGATTCCAAGCTCGCGTCTAGGGATTCGAAATGGAAT
JMSF050D05+ TAGCTCTGCTCAACTCGCAATGCAGATTCCAAGCTNGCGTCTAGGGATTCGAAATGGAAT
                      ____________________________________________________________
consensus TAGCTCTGCTCAACTCGCAATGCAGATTCCAAGCTCGCGTCTAGGGATTCGAAATGGAAT
 
. : . : . : . : . : . :
JMSF040N21+ CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATGGAAT
JMSF050L23+ CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATG
JMFF010A05+ CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATGGAATGAGAGCTGTGAAATAGGTA
JMFF036C04+ CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATGGAATGAG
JMFF042B02+ CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATGGAATGAGAGCTGTGAAATAGGTA
JMSF048E15+ CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATGGAATGAGAGCTGTGAAATAGGTA
JMSF050D05+ CTCGACTCCNAAATGAAGGGAAGAAGAGGAGAAAATGGAATGAGAGCTGTGAAATAGGTA
                      ____________________________________________________________
consensus CTCGACTCCGAAATGAAGGGAAGAAGAGGAGAAAATGGAATGAGAGCTGTGAAATAGGTA
 
. : . : . : . : . : . :
JMFF010A05+ CAGCCTTTCTTATA
JMFF042B02+ CAGCCTTTCTTATACT
JMSF048E15+ CAGCCTTTCTTATACTATTCCGAACTCACCAATCCACCAATCCTTTTGTC
JMSF050D05+ CAGCCTTTNTTATANTATTCCGAACTCACCAATCCACCAATCCTTTTGTCAATCCTGTTA
                      ____________________________________________________________
consensus CAGCCTTTCTTATACTATTCCGAACTCACCAATCCACCAATCCTTTTGTCAATCCTGTTA