Previous Contig 007971:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029D03Sequence667007971 (2)gb:AY081318_15686641e-19Arabidopsis thaliana unknown protein (At5g50840) mRNA, complete cds.>gb:BT008857725023375gb:AY081318_15686645e-75Arabidopsis thaliana unknown protein (At5g50840) mRNA, complete cds.>gb:BT008857
JMSF050C08Sequence680007971 (2)gb:AY081318_15686646e-22Arabidopsis thaliana unknown protein (At5g50840) mRNA, complete cds.>gb:BT008857222013810 (6)gb:BT002379_16359822e-21Arabidopsis thaliana Unknown protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF029D03+ CCCGAACA
JMSF050C08+ ACTCTAGTTTATCCCGAACA
                      ____________________________________________________________
consensus ACTCTAGTTTATCCCGAACA
 
. : . : . : . : . : . :
JMSF029D03+ GCAATAGCTGAATCTCTTTCAGCAAGAACTTGTTGATACTTTAGTGTGAACTCCAAAAAC
JMSF050C08+ GCAATAGCTGAATCTCTTTCAGCAAGAACTTGTTGATACTTTAGTGTGAACTCCAAAAAC
                      ____________________________________________________________
consensus GCAATAGCTGAATCTCTTTCAGCAAGAACTTGTTGATACTTTAGTGTGAACTCCAAAAAC
 
. : . : . : . : . : . :
JMSF029D03+ TCCTTCTCAGATTTAAATGTACGTTTTACATTCTTCCGTTTTACATCAGAGGCTTCTGTT
JMSF050C08+ TCCTTCTCAGATTTAAATGTACGTTTTACATTCTTCCGTTTTACATCAGAGGCTTCTGTT
                      ____________________________________________________________
consensus TCCTTCTCAGATTTAAATGTACGTTTTACATTCTTCCGTTTTACATCAGAGGCTTCTGTT
 
. : . : . : . : . : . :
JMSF029D03+ TTCCTGTTCTCTGAACTATCGAGTGATGGCGCCTCATTAGTGGTCAGTGTCTGTTGATCT
JMSF050C08+ TTCCTGTTCTCTGAACTATCGAGTGATGGCGCCTCATTAGTGGTCAGTGTCTGTTGATCT
                      ____________________________________________________________
consensus TTCCTGTTCTCTGAACTATCGAGTGATGGCGCCTCATTAGTGGTCAGTGTCTGTTGATCT
 
. : . : . : . : . : . :
JMSF029D03+ GAGCCTTCTACAGTTGAATTTTCCAAGCTCAAGCTCTGTACTTTAGCTTGTTCCTCCTCC
JMSF050C08+ GAGCCTTCTACAGTTGAATTTTCCAAGCTCAAGCTCTGTACTTTAGCTTGTTCCTCCTCC
                      ____________________________________________________________
consensus GAGCCTTCTACAGTTGAATTTTCCAAGCTCAAGCTCTGTACTTTAGCTTGTTCCTCCTCC
 
. : . : . : . : . : . :
JMSF029D03+ GCCGCCGTTTCTCGGCAGCCACTTACTGCAGGGAGGGCAAAATGGTTATCATTTACGATG
JMSF050C08+ GCCGCCGTTTCTCGGCAGCCACTTACTGCAGGGAGGGCAAAATGGTTATCATTTACGATG
                      ____________________________________________________________
consensus GCCGCCGTTTCTCGGCAGCCACTTACTGCAGGGAGGGCAAAATGGTTATCATTTACGATG
 
. : . : . : . : . : . :
JMSF029D03+ AGCACGGGCCTCACCTCAGGCTCCTCTAATTTATCCTCCGGGGCGAGTGGCTTTTCCTGG
JMSF050C08+ AGCACGGGCCTCACCTCAGGCTCCTCTAATTTATCCTCCGGGGCGAGTGGCTTTTCCTGG
                      ____________________________________________________________
consensus AGCACGGGCCTCACCTCAGGCTCCTCTAATTTATCCTCCGGGGCGAGTGGCTTTTCCTGG
 
. : . : . : . : . : . :
JMSF029D03+ TCGGGGGTGGGTGTTTCCGGCGCCAACGAGTCAGCGCCGGAGCTATCCACGAAGCCGTCG
JMSF050C08+ TCGGGGGTGGGTGTTTCCGGCGCCAACGAGTCAGCGCCGGAGCTATCCACGAAGCCGTCG
                      ____________________________________________________________
consensus TCGGGGGTGGGTGTTTCCGGCGCCAACGAGTCAGCGCCGGAGCTATCCACGAAGCCGTCG
 
. : . : . : . : . : . :
JMSF029D03+ GGTAATGAATCCGCCTCCGGCAGCTGATTTGCAGCTGGATTCAGTTTTGCGTCCTCATTC
JMSF050C08+ GGTAATGAATCCGCCTCCGGCAGCTGATTTGCGGCTGGATTCAGTTTTGCGTCCTCATTC
                      ____________________________________________________________
consensus GGTAATGAATCCGCCTCCGGCAGCTGATTTGCGGCTGGATTCAGTTTTGCGTCCTCATTC
 
. : . : . : . : . : . :
JMSF029D03+ TCCATCTCGCCTACACTCACTCCAAGACGAAAGGGGAAAACCACCAAAACTCCACGTTTT
JMSF050C08+ TCCATCTCGCCTACACTCACTCCAAGACGAAAGGGGAAAACCACCAAAACTCCACGTTTT
                      ____________________________________________________________
consensus TCCATCTCGCCTACACTCACTCCAAGACGAAAGGGGAAAACCACCAAAACTCCACGTTTT
 
. : . : . : . : . : . :
JMSF029D03+ TTCAGTAAAGAACCCTAGGCCCTAGCTAGCTAAGCTCTGCGCTCGGACTTCAGATCATCT
JMSF050C08+ TTCAGTAAAGAACCCTAGGCCCTAGCTAGCTAAGCTCTGCGCTCGGACTTCAGATCATCT
                      ____________________________________________________________
consensus TTCAGTAAAGAACCCTAGGCCCTAGCTAGCTAAGCTCTGCGCTCGGACTTCAGATCATCT
 
. : . : . : . : . : . :
JMSF029D03+ GTAAAGAAAAGTAGTGTCGCGGAAACCGATTGCACTCGATCTGTACAACAAGGCTCGTC
JMSF050C08+ GTAAAGAAAAGTAGTGTCGCGGAAACCGATTGCACTCGATCTGTACAACAAGGCTCGTCC
                      ____________________________________________________________
consensus GTAAAGAAAAGTAGTGTCGCGGAAACCGATTGCACTCGATCTGTACAACAAGGCTCGTCC