Previous Contig 007970:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013I13Sequence379007970 (5)gb:AB042860_15199522e-26Panax ginseng RPL29 mRNA for ribosomal protein L29, complete cds.
JMFN007I01Sequence323007970 (5)gb:AB042860_15199522e-26Panax ginseng RPL29 mRNA for ribosomal protein L29, complete cds.
JMFN017H08Sequence389007970 (5)gb:AB042860_15199522e-26Panax ginseng RPL29 mRNA for ribosomal protein L29, complete cds.
JMFN043O06Sequence482007970 (5)gb:AB042860_15199522e-26Panax ginseng RPL29 mRNA for ribosomal protein L29, complete cds.
JMSF050B24Sequence407007970 (5)gb:AB042860_15199522e-26Panax ginseng RPL29 mRNA for ribosomal protein L29, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043O06+ AAAACACACAATCATCTG
                      ____________________________________________________________
consensus AAAACACACAATCATCTG
 
. : . : . : . : . : . :
JMFN043O06+ CCATTAACACCAAGAGGAAAAACATGAGGCATATCAAACCATCAAAAGCACAGGGTCTAT
                      ____________________________________________________________
consensus CCATTAACACCAAGAGGAAAAACATGAGGCATATCAAACCATCAAAAGCACAGGGTCTAT
 
. : . : . : . : . : . :
JMFN043O06+ GAAGACACTAAAAGTGAACAACTGGAAAGGGAACAATCCTCAATAAAGGCAAAAACTTAA
JMFN017H08+ TGGAAAGGGAACAATCCTCAATAAAGGCAAAAACTTAA
rJMFF013I13- AAAAACTTAA
JMSF050B24+ TGGAAAGGGAACAATCCTCAATAAAGGCAAAAACTTAA
                      ____________________________________________________________
consensus GAAGACACTAAAAGTGAACAACTGGAAAGGGAACAATCCTCAATAAAGGCAAAAACTTAA
 
. : . : . : . : . : . :
JMFN043O06+ TAGGTTATGTCAAAACATAATAATAGTAACCAAGTTTTGGCACTAGCTCAAAAACAACAA
JMFN017H08+ TAGGTTATGTCAAAACATAATAATAGTAACCAAGTTTTGGCACTAGCTCAAAAACAACAA
JMFN007I01+ AATAGTAACCAAGTTTTGGCACTAGCTCAAAAACAACAA
rJMFF013I13- TAGGTTATGTCAAAACATAATAATAGTAACCAAGTTTTGGCACTAGCTCAAAAACAACAA
JMSF050B24+ TAGGTTATGTCAAAACATAATAATAGTAACCAAGTTTTGGCACTAGCTCAAAAACAACAA
                      ____________________________________________________________
consensus TAGGTTATGTCAAAACATAATAATAGTAACCAAGTTTTGGCACTAGCTCAAAAACAACAA
 
. : . : . : . : . : . :
JMFN043O06+ GTAGAATCCCAACATTCCAAAATCAAGGTGTATTTAACCTAAACACAAACAAGATCTACT
JMFN017H08+ GTAGAATCCCAACATTCCAAAATCAAGGTGTATTTAACCTAAACACAAACAAGATCTACT
JMFN007I01+ GTAGAATCCCAACATTCCAAAATCAAGGTGTATTTAACCTAAACACAAACAAGATCTACT
rJMFF013I13- GTAGAATCCCAACATTCCAAAATCAAGGTGTATTTAACCTAAACACAAACAAGATCTACT
JMSF050B24+ GTAGAATCCCAACATTCCAAAATCAAGGTGTATTTAACCTAAACACAAACAAGATCTACT
                      ____________________________________________________________
consensus GTAGAATCCCAACATTCCAAAATCAAGGTGTATTTAACCTAAACACAAACAAGATCTACT
 
. : . : . : . : . : . :
JMFN043O06+ CCTCTCCGCTTCCAGCTTCACCGCTCTTGTTGTTGTGCTTCCTAGCATACCTTTGGTTCC
JMFN017H08+ CCTCTCCGCTTCCAGCTTCACCGCTCTTGTTGTTGTGCTTCCTAGCATACCTTTGGTTCC
JMFN007I01+ CCTCTCCGCTTCCAGCTTCACCGCTCTTGTTGTTGTGCTTCCTAGCATACCTTTGGTTCC
rJMFF013I13- CCTCTCCGCTTCCAGCTTCACCGCTCTTGTTGTTGTGCTTCCTAGCATACCTTTGGTTCC
JMSF050B24+ CCTCTCCGCTTCCAGCTTCACCGCTCTTGTTGTTGTGCTTCCTAGCATACCTTTGGTTCC
                      ____________________________________________________________
consensus CCTCTCCGCTTCCAGCTTCACCGCTCTTGTTGTTGTGCTTCCTAGCATACCTTTGGTTCC
 
. : . : . : . : . : . :
JMFN043O06+ TCAAGAACTTAGGGTCCATCCCTTTGGTGGATGTGTGACGGTGCTTTCTGGGCTTCTTGA
JMFN017H08+ TCAAGAACTTAGGGTCCATCCCTTTGGTGGATGTGTGACGGTGCTTTCTGGGCTTCTTGA
JMFN007I01+ TCAAGAACTTAGGGTCCATCCCTTTGGTGGATGTGTGACGGTGCTTTCTGGGCTTCTTGA
rJMFF013I13- TCAAGAACTTAGGGTCCATCCCTTTGGTGGATGTGTGACGGTGCTTTCTGGGCTTCTTGA
JMSF050B24+ TCAAGAACTTAGGGTCCATCCCTTTGGTGGATGTGTGACGGTGCTTTCTGGGCTTCTTGA
                      ____________________________________________________________
consensus TCAAGAACTTAGGGTCCATCCCTTTGGTGGATGTGTGACGGTGCTTTCTGGGCTTCTTGA
 
. : . : . : . : . : . :
JMFN043O06+ TGCCATTCTTGTGCGCCTTGTAGGACTGGTTGTGAGCTGTGTGATTCTTTGACTTCGCCA
JMFN017H08+ TGCCATTCTTGTGCGCCTTGTAGGACTGGTTGTGAGCTGTGTGATTCTTTGACTTCGCCA
JMFN007I01+ TGCCATTCTTGTGCGCCTTGTAGGACTGGTTGTGAGCTGTGTGATTCTTTGACTTCGCCA
rJMFF013I13- TGCCATTCTTGTGCGCCTTGTAGGACTGGTTGTGAGCTGTGTGATTCTTTGACTTCGCCA
JMSF050B24+ TGCCATTCTTGTGCGCCTTGTAGGACTGGTTGTGAGCTGTGTGATTCTTTGACTTCGCCA
                      ____________________________________________________________
consensus TGCCATTCTTGTGCGCCTTGTAGGACTGGTTGTGAGCTGTGTGATTCTTTGACTTCGCCA
 
. : . : . : . : . : . :
JMFN043O06+ TTCCTGCTTCTCTTCCTCACGGAGGAACTGTGTTCGGGATTTCA
JMFN017H08+ TTCCTGCTTCTCTTCCTCACGGAGGAACTGTGTTCGGGATTTCA
JMFN007I01+ TTCCTGCTTCTCTTCCTCACGGAGGAACTGTGTTCGGGATTTCA
rJMFF013I13- TTCCTGCTTCTCTTCCTCACGGAGGAACTGTGTTCGGGATTTCAGCAGCTGCAACT
JMSF050B24+ TTCCTGCTTCTCTTCCTCACGGAGGAACTGTGTTCGGGATTTCAGCAGCTGCAACTAGCC
                      ____________________________________________________________
consensus TTCCTGCTTCTCTTCCTCACGGAGGAACTGTGTTCGGGATTTCAGCAGCTGCAACTAGCC