Previous Contig 007968:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS151G02Sequence624007968 (2)pir|T52459|T524592e-78sensory transduction histidine kinase 1 [validated] - Arabidopsis thaliana>gb:AB
JMSF050B19Sequence688007968 (2)pir|T52459|T524591e-54sensory transduction histidine kinase 1 [validated] - Arabidopsis thaliana>gb:AB187003640 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS151G02+ CAACAGCAACTATGCTTTCATTGGATGGATCCCAAACTGGAAGTGCAGAAG
                      ____________________________________________________________
consensus CAACAGCAACTATGCTTTCATTGGATGGATCCCAAACTGGAAGTGCAGAAG
 
. : . : . : . : . : . :
JMFS151G02+ AAAGCAGCGGTGAATCACTGAACTTGCTTACCGCTACATGCCATGTCGCTGCACCATCAG
                      ____________________________________________________________
consensus AAAGCAGCGGTGAATCACTGAACTTGCTTACCGCTACATGCCATGTCGCTGCACCATCAG
 
. : . : . : . : . : . :
JMFS151G02+ GTACTTGCGAAATTCCTGCAATATTGATTAACTCATCTGGTGGAATTTGACTTTTTCTTC
                      ____________________________________________________________
consensus GTACTTGCGAAATTCCTGCAATATTGATTAACTCATCTGGTGGAATTTGACTTTTTCTTC
 
. : . : . : . : . : . :
JMFS151G02+ CAACCCTGACACCTGTCAGAGGATCCAGAGTTTCTCTGTACCAAATTGCTGTTGTGTTGT
                      ____________________________________________________________
consensus CAACCCTGACACCTGTCAGAGGATCCAGAGTTTCTCTGTACCAAATTGCTGTTGTGTTGT
 
. : . : . : . : . : . :
JMFS151G02+ TGTGTATAGATTGGTCGTTCCACCCTTGACGAGATGTCAACATACTGACATCGTATGTTC
JMSF050B19+ GATGTCAACATACTGACATCGTATGTTC
                      ____________________________________________________________
consensus TGTGTATAGATTGGTCGTTCCACCCTTGACGAGATGTCAACATACTGACATCGTATGTTC
 
. : . : . : . : . : . :
JMFS151G02+ CACTTATTGAATAATTGGAAAGATCTGAGTATATGTAGAATGTATTGTTACTTCTATGGT
JMSF050B19+ CACTTATTGAATAATTGGAAAGATCTGAGTATATGTAGAATGTATTGTTACTTCTATGGT
                      ____________________________________________________________
consensus CACTTATTGAATAATTGGAAAGATCTGAGTATATGTAGAATGTATTGTTACTTCTATGGT
 
. : . : . : . : . : . :
JMFS151G02+ CTCTGTGGAAAGCCTGGACAAAACCATTTTTGTAACTGATTGTTATCGAATTCAGAGCCT
JMSF050B19+ CTCTGTGGAAAGCCTGGACAAAACCATTTTTGTAACTGATTGTTATCGAATTCAGAGCCT
                      ____________________________________________________________
consensus CTCTGTGGAAAGCCTGGACAAAACCATTTTTGTAACTGATTGTTATCGAATTCAGAGCCT
 
. : . : . : . : . : . :
JMFS151G02+ TCCGGCTGGAAAACAATGCCCATGTTACATCCCTCATGACTTCATATAGCTCAGCTTGCT
JMSF050B19+ TCCGGCTGGCAAACAATGCCCATGTTACATCCCTCATGACTTCATATAGCTCAGCTTGCT
                      ____________________________________________________________
consensus TCCGGCTGGCAAACAATGCCCATGTTACATCCCTCATGACTTCATATAGCTCAGCTTGCT
 
. : . : . : . : . : . :
JMFS151G02+ GTGCTTGATTTACAGGCTTGCTATATCGTTTGATTACATATTCTGACAATTTAACCTGGG
JMSF050B19+ GTGCTTGATTTACAGGCTTGCTATATCGTTTGATTACATATTCTGACAATTTAACCTGGG
                      ____________________________________________________________
consensus GTGCTTGATTTACAGGCTTGCTATATCGTTTGATTACATATTCTGACAATTTAACCTGGG
 
. : . : . : . : . : . :
JMFS151G02+ CAGTTGCTATTTCGACAGTAGAATTGAGGATGTTCCACATTCGCAAAATAGGCCTTTGAA
JMSF050B19+ CAGTTGCTATTTCGACAGTAGAATTGAGGATGTTCCACATTCGCAAAATAGGCCTTTGAA
                      ____________________________________________________________
consensus CAGTTGCTATTTCGACAGTAGAATTGAGGATGTTCCACATTCGCAAAATAGGCCTTTGAA
 
. : . : . : . : . : . :
JMFS151G02+ GTAGCTCATGTCGAAGCCCAAATGCCAATGTGT
JMSF050B19+ GTAGCTCATGTCGAAGCCCAAATGCCAATGTGTTCAATGACCTGGTTGTGTAAACTCATG
                      ____________________________________________________________
consensus GTAGCTCATGTCGAAGCCCAAATGCCAATGTGTTCAATGACCTGGTTGTGTAAACTCATG
 
. : . : . : . : . : . :
JMSF050B19+ ATAGCAAGGCGGACCACAAAAACGCTATAGTATGAAGATAAACAAAGGGTACTTGCATCC
                      ____________________________________________________________
consensus ATAGCAAGGCGGACCACAAAAACGCTATAGTATGAAGATAAACAAAGGGTACTTGCATCC
 
. : . : . : . : . : . :
JMSF050B19+ TGAAATTCTTCCTCTTCTACATCCCTATTGAAATTTCTCCGGCTACTAGGAGATTGGTTG
                      ____________________________________________________________
consensus TGAAATTCTTCCTCTTCTACATCCCTATTGAAATTTCTCCGGCTACTAGGAGATTGGTTG
 
. : . : . : . : . : . :
JMSF050B19+ CTTGTGCAAAACATCCCAGAGCTAAACATCCTGCAGAAAATTCTCTCAAGGACTGATCCC
                      ____________________________________________________________
consensus CTTGTGCAAAACATCCCAGAGCTAAACATCCTGCAGAAAATTCTCTCAAGGACTGATCCC
 
. : . : . : . : . : . :
JMSF050B19+ TTTGGTGTGATAGAAGGCGATAAGGATTCAGAGCTGACAGGACTTGTATTGGATCCAAAA
                      ____________________________________________________________
consensus TTTGGTGTGATAGAAGGCGATAAGGATTCAGAGCTGACAGGACTTGTATTGGATCCAAAA
 
. : . : . : . : . : . :
JMSF050B19+ GCCATTCCTCATATTATTCCCAACAGTAAAGCAAGATATGGTTATGCGGTAGAAAGCTGA
                      ____________________________________________________________
consensus GCCATTCCTCATATTATTCCCAACAGTAAAGCAAGATATGGTTATGCGGTAGAAAGCTGA