Previous Contig 007967:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF045E07Sequence699007967 (5)824013601 (2)
JMSF046A08Sequence748005659 (7)684007967 (5)
JMSF049L16Sequence641007943 (2)678007967 (5)
JMSF050B18Sequence334007967 (5)590013870 (4)
JMSF052D22Sequence666005659 (7)865007967 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052D22+ TAGGGCTTTAGGGATTTACAGTAAAATGTAAGTCTCTT
                      ____________________________________________________________
consensus TAGGGCTTTAGGGATTTACAGTAAAATGTAAGTCTCTT
 
. : . : . : . : . : . :
rJMSF052D22+ ATTAGTCCATTTCTATGACTGTTTCAATCCAGGACTGTTTCAATTCACTTATAGGAGTCC
                      ____________________________________________________________
consensus ATTAGTCCATTTCTATGACTGTTTCAATCCAGGACTGTTTCAATTCACTTATAGGAGTCC
 
. : . : . : . : . : . :
rJMSF052D22+ AGTCGTATTTCCACAGTTAGTTATTTTATTTGCAAATGATGGTTGTATACTTTCCACAGT
                      ____________________________________________________________
consensus AGTCGTATTTCCACAGTTAGTTATTTTATTTGCAAATGATGGTTGTATACTTTCCACAGT
 
. : . : . : . : . : . :
rJMSF052D22+ TAGTTCTTTTATTTGCAAATGATGAGTACAGATCTGTTTCTTACCTCTTGATGCAAGGTT
rJMSF046A08+ ATCTGTTTCTTACCTCTTGATGCAAGGTT
                      ____________________________________________________________
consensus TAGTTCTTTTATTTGCAAATGATGAGTACAGATCTGTTTCTTACCTCTTGATGCAAGGTT
 
. : . : . : . : . : . :
rJMSF052D22+ ATTTGTTTTGCCGGGCATATTTTAACAGATGAATGCCA-GAATTAT-GTTTTAAATATCT
rJMSF046A08+ ATTTGNTTTGCCGGGCATATTTTAACAGATGAATGCCAGGAATTATGGTTTTAAATATCT
JMSF045E07- GGGCATATTTTAACAGATGAATGCCA-GAATTAT-GTTTTAAATATCT
                      ____________________________________________________________
consensus ATTTGTTTTGCCGGGCATATTTTAACAGATGAATGCCA-GAATTAT-GTTTTAAATATCT
 
. : . : . : . : . : . :
rJMSF052D22+ G-TTTCTTAACTATTGATGCAAGGTGATTTGTTTTTCTTTAGGAACTGAATTCAATATTT
rJMSF046A08+ GTTTTCTTAACTATTGATGCAAGGTGATTTGTTTTTCTTTAGGAACTGAATTCAATATTT
JMSF045E07- G-TTTCTTAACTATTGATGCAAGGTGATTTGTTTTTCTTTAGGAACTGAATTCAATATTT
                      ____________________________________________________________
consensus G-TTTCTTAACTATTGATGCAAGGTGATTTGTTTTTCTTTAGGAACTGAATTCAATATTT
 
. : . : . : . : . : . :
rJMSF052D22+ AAAATCTTTAACTCACAACAGAAAATGGAATCACTGTTTGTTTTTCCTTTAGCTTGATTT
rJMSF046A08+ AAAATCTTTAACTCACAACAGAAAATGGAATCACTGTTTGTTTTTCCTTTAGCTTGATTT
JMSF045E07- AAAATCTTTAACTCACAACAGAAAATGGAATCACTGTTTGTTTTTCCTTTAGCTTGATTT
                      ____________________________________________________________
consensus AAAATCTTTAACTCACAACAGAAAATGGAATCACTGTTTGTTTTTCCTTTAGCTTGATTT
 
. : . : . : . : . : . :
rJMSF052D22+ CATCTGAAAATTAATTTGATCTGAAAATATTTAGTCAACTTAGGTTTATTTTAGATAAGA
rJMSF046A08+ CATCTGAAAATTAATTTGATCTGAAAATATTTAGTCAACTTAGGTTTATTTTAGATAAGA
JMSF045E07- CATCTGAAAATTAATTTGATCTGAAAATATTTAGTCAACTTAGGTTTATTTTAGATAAGA
                      ____________________________________________________________
consensus CATCTGAAAATTAATTTGATCTGAAAATATTTAGTCAACTTAGGTTTATTTTAGATAAGA
 
. : . : . : . : . : . :
rJMSF052D22+ ATTGTGTGCTTGGATGTTACAGAGAACTTGCATAAATGTTTGTTTTCCCTTTAGCTTTTG
rJMSF046A08+ ATTGTGTGCTTGGATGTTACAGAGAACTTGCATAAATGTTTGTTTTCCCTTTAGCTTTTG
JMSF045E07- ATTGTGTGCTTGGATGTTACAGAGAACTTGCATAAATGTTTGTTTTCCCTTTAGCTTTTG
                      ____________________________________________________________
consensus ATTGTGTGCTTGGATGTTACAGAGAACTTGCATAAATGTTTGTTTTCCCTTTAGCTTTTG
 
. : . : . : . : . : . :
rJMSF052D22+ TTTAAAAAGAAAAAATAAACAATAGGTAACATCATCTGAAACTTAATAATATTTTTGAAC
rJMSF046A08+ TTTAAAAAGAAAAAATAAACAATAGGTAACATCATCTGAAACTTAATAATATTTTTGAAC
JMSF045E07- TTTAAAAAGAAAAAATAAACAATAGGTAACATCATCTGAAACTTAATAATATTTTTGAAC
                      ____________________________________________________________
consensus TTTAAAAAGAAAAAATAAACAATAGGTAACATCATCTGAAACTTAATAATATTTTTGAAC
 
. : . : . : . : . : . :
rJMSF052D22+ TGTAGTTTATTTTAAATAAGAATTGGTGTAGTTTAACCTTTCATCAACTTTTTTGTATGT
rJMSF046A08+ TGTAGTTTATTTTAAATAAGAATTGGTGTAGTTTAACCTTTCATCAACTTTTTTGTATGT
JMSF045E07- TGTAGTTTATTTTAAATAAGAATTGGTGTAGTTTAACCTTTCATCAACTTTTTTGTATGT
                      ____________________________________________________________
consensus TGTAGTTTATTTTAAATAAGAATTGGTGTAGTTTAACCTTTCATCAACTTTTTTGTATGT
 
. : . : . : . : . : . :
rJMSF052D22+ TTAGCATTTGTTTTAGGTAAATGTAGATGACTAAATTCCACAATCTTTTATATATAAGAT
rJMSF046A08+ TTAGCATTTGTTTTAGGTAAATGTAGATGACTAAATTCCACAATCCTTTATATATAAGAT
JMSF045E07- TTAGCATTTGTTTTAGGTAAATGTAGATGACTAAATTCCACAATCTTTTATATATAAGAT
                      ____________________________________________________________
consensus TTAGCATTTGTTTTAGGTAAATGTAGATGACTAAATTCCACAATCTTTTATATATAAGAT
 
. : . : . : . : . : . :
rJMSF052D22+ CCAACTCTATTAGAAATCTTAAGAATACTCAAAAAAATTACAACTACAAAAGACTTGCAA
rJMSF046A08+ CCAACTCTATTAGAAATCTTAAGAATACTCAAAAAAATTACAACTACAAAAGACTTGCAA
JMSF045E07- CCAACTCTATTAGAAATCTTAAGAATACTCAAAAAAATTACAACTACAAAAGACTTGCAA
rJMSF049L16+ AAATTACNAGTACAAAAGACTTGCAA
                      ____________________________________________________________
consensus CCAACTCTATTAGAAATCTTAAGAATACTCAAAAAAATTACAACTACAAAAGACTTGCAA
 
. : . : . : . : . : . :
rJMSF052D22+ CTACAAAAGACTTGGTAAAAATACAACACCAAAATACAGTTAGATACACAATACAATATA
rJMSF046A08+ CTACAAAAGACTTGGTAAAAATACAACACCAAAATACAGTTAGATACACAATACAATATA
JMSF045E07- CTACAAAAGACTTGGTAAAAATACAACACCAAAATACAGTTAGATACACAATACAATATA
rJMSF049L16+ CAACAAAAGNCTTGGTAAAAATACAACACCAAAATNCAGTTAGATACACAATACAATATA
                      ____________________________________________________________
consensus CTACAAAAGACTTGGTAAAAATACAACACCAAAATACAGTTAGATACACAATACAATATA
 
. : . : . : . : . : . :
rJMSF052D22+ TGATTGTGCTTTTAGCTGATTCCTTGAAAANCTGGTAGCCTTCATTGCTG
rJMSF046A08+ TGATTGTGCTTTTAGCTGATTCCTTGAAAANCTGGTAGCCTTCATTGCTG
JMSF045E07- TGATTGTGCTTTTAGCTGATTCCTTGAAAA-CTGGTAGCCTTCATTGCTGGTTCTTGATA
rJMSF049L16+ TGATTGTGGTTTTAGCTGATGCCTTGAAAA-CTAATAGCCTTCATTGCNGGTTCNTGATA
                      ____________________________________________________________
consensus TGATTGTGCTTTTAGCTGATTCCTTGAAAA-CTGGTAGCCTTCATTGCTGGTTCTTGATA
 
. : . : . : . : . : . :
JMSF045E07- TTCAACCTGCATATAGTCACTTACACAATACAATACCAAAATACCAAAAAA
rJMSF049L16+ TTCANCCTGCATACAGTTAGATACACAATACAATACCAAAATACAAAAAAAGAGCCAAAT
                      ____________________________________________________________
consensus TTCAACCTGCATATAGTTAGTTACACAATACAATACCAAAATACCAAAAAAGAGCCAAAT
 
. : . : . : . : . : . :
rJMSF049L16+ TACTCANAANCAGNTAGTTCNAAAANTGATTGTCAAAAACCAATATCCAAAAACCCCAAA
JMSF050B18- A
                      ____________________________________________________________
consensus TACTCANAANCAGNTAGTTCNAAAANTGATTGTCAAAAACCAATATCCAAAAACCCCAAA
 
. : . : . : . : . : . :
rJMSF049L16+ ACCACACAAAGGTGGTCAATTGTNTTACACTTTATCAATTCCAAACCAACAGAGCNTCAA
JMSF050B18- ACCACACAGAGGTGGACAATTGTCTTACAGTTTCTCAATTCCAAACCAACAGAACAGAAA
                      ____________________________________________________________
consensus ACCACACAGAGGTGGTCAATTGTCTTACAGTTTCTCAATTCCAAACCAACAGAGCATCAA
 
. : . : . : . : . : . :
rJMSF049L16+ TATCAAATTGTTTAATTTTNCAATCAAACTTTAGGCTTCTTAACCTTGCCAGAAGAAGAG
JMSF050B18- GATCACATTGTTTAGTTTTACAATCAAACTTTAGGCTTCTTAACCTTGCTAGAAGAACAG
                      ____________________________________________________________
consensus TATCACATTGTTTAGTTTTACAATCAAACTTTAGGCTTCTTAACCTTGCTAGAAGAAGAG
 
. : . : . : . : . : . :
rJMSF049L16+ AACTCATCAAGGAGTGATCTCTTAACCACAGTGCAGTCCTCCAAATCAACCACATGGGCT
JMSF050B18- AACTCATCAAGGAGTGATCTCTTACCCACATTACAGTCTTCCAAATCAGCCACA--GGCT
                      ____________________________________________________________
consensus AACTCATCAAGGAGTGATCTCTTACCCACATTGCAGTCTTCCAAATCAGCCACATGGGCT
 
. : . : . : . : . : . :
rJMSF049L16+ CTGAGTTTGCTGAACACTAATTGGGCTGTTGACCTCATTATCACCATTGGATG
JMSF050B18- CTGAGTTTGCTGAACACCGGTTGGGCTGTTGACCTCATTATCACCATTGGATGCTTCCTA
                      ____________________________________________________________
consensus CTGAGTTTGCTGAACACTGGTTGGGCTGTTGACCTCATTATCACCATTGGATGCTTCCTA
 
. : . : . : . : . : . :
JMSF050B18- TAAATGGAAGCATTGATTTAGTTTTCAAACTTAGGCAAAAGTATAAAAACAAAAAAAAAA
                      ____________________________________________________________
consensus TAAATGGAAGCATTGATTTAGTTTTCAAACTTAGGCAAAAGTATAAAAACAAAAAAAAAA