Previous Contig 007964:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN015I11Sequence594007964 (2)gb:AF144708_17719875e-28Pisum sativum Tha4 protein (Tha4) mRNA, complete cds; nuclear gene for chloropla
JMSF050A11Sequence668007964 (2)gb:AC145379_17443455e-25Oryza sativa chromosome 3 BAC OSJNBa0010N03 genomic sequence, complete sequence.695008714 (18)gb:AF227979_17788893e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN015I11- GAGAACTAGTCTCAGXXXXXXXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus GAGAACTAGTCTCAGNNNNNNNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFN015I11- XXXXAAAATAAAAGTTGGATTACATTTCCGTGCAGTTTAATTCTTCCCGCAAAAAACACC
                      ____________________________________________________________
consensus NNNNAAAATAAAAGTTGGATTACATTTCCGTGCAGTTTAATTCTTCCCGCAAAAAACACC
 
. : . : . : . : . : . :
JMFN015I11- AGATTAGGACTGAGCAGTCTACGTAATTGATTATCGTCCGAGAAAGTGAAACAACTACGC
                      ____________________________________________________________
consensus AGATTAGGACTGAGCAGTCTACGTAATTGATTATCGTCCGAGAAAGTGAAACAACTACGC
 
. : . : . : . : . : . :
JMFN015I11- GAAACAAAACAGCATCTCAACACAGCTAATGCTTATAACACGCAATACGAGAATTACCTA
                      ____________________________________________________________
consensus GAAACAAAACAGCATCTCAACACAGCTAATGCTTATAACACGCAATACGAGAATTACCTA
 
. : . : . : . : . : . :
JMFN015I11- AACTAGAAGCAGTAGCAAACGAGTTGCTGTGGCAGTTTACGAGTCCTCCTTTGTGCTGGA
                      ____________________________________________________________
consensus AACTAGAAGCAGTAGCAAACGAGTTGCTGTGGCAGTTTACGAGTCCTCCTTTGTGCTGGA
 
. : . : . : . : . : . :
JMFN015I11- CACTGTAGCGTCCCGTTTCTCTTGTTGATTTATTTCTTCGACTCCCTCGGAAGGGGCCTG
                      ____________________________________________________________
consensus CACTGTAGCGTCCCGTTTCTCTTGTTGATTTATTTCTTCGACTCCCTCGGAAGGGGCCTG
 
. : . : . : . : . : . :
JMFN015I11- AGCTAGAGAATCAGGTTCCTTTTTCAGTTCTGTTTCGAATTCCTTTGCTGCCTGTTGGAA
JMSF050A11+ TTCAAACTCTTTTGCTGCCTGTTGGAA
                      ____________________________________________________________
consensus AGCTAGAGAATCAGGTTCCTTTTTCAGTTCTGTTTCGAATTCTTTTGCTGCCTGTTGGAA
 
. : . : . : . : . : . :
JMFN015I11- GCCCTTAAAAGTCTTGCCAATACTGCGGCCAACTTCGGGAAGCTTCTTAGGGCCGAAGAC
JMSF050A11+ GCTCTTGAGGGTCTTGCCAAGACCGCGGCCGATTTCGGGCAACTGCTTAGGGCCGAAGAT
                      ____________________________________________________________
consensus GCTCTTGAGGGTCTTGCCAATACTGCGGCCGATTTCGGGCAGCTTCTTAGGGCCGAAGAT
 
. : . : . : . : . : . :
JMFN015I11- GAGGGCGGCGACACCAGCAATGACCACCAGCTCCGGCACCCCAAGCCCGAACAAGCAGTT
JMSF050A11+ AAGGGCGGTGACACCGGCAATGACCACCAGNTCCGGCACCCCAAGCCCGAATAAGCAGTT
                      ____________________________________________________________
consensus GAGGGCGGTGACACCGGCAATGACCACCAGCTCCGGCACCCCAAGCCCGAATAAGCAGTT
 
. : . : . : . : . : . :
JMFN015I11- GCAAGAAAACCGCTTT
JMSF050A11+ GCAATAAAGACGCTTTCTACCATTGCTCCTAACATTACAAGTTCTCAGACCCAAACTCCG
                      ____________________________________________________________
consensus GCAATAAAGCCGCTTTCTACCATTGCTCCTAACATTACAAGTTCTCAGACCCAAACTCCG
 
. : . : . : . : . : . :
JMSF050A11+ TTTGAGCCCGCCCGGGTTGCTGCTGAAGAACAATGAGCTAGAGGAAGAAAAAGCGGCCAC
                      ____________________________________________________________
consensus TTTGAGCCCGCCCGGGTTGCTGCTGAAGAACAATGAGCTAGAGGAAGAAAAAGCGGCCAC
 
. : . : . : . : . : . :
JMSF050A11+ TGAAGAAGTGGGCTTTGGTGCGAATGAGAGCGACACAGCGGACGCTATGGCCGCCATTTC
                      ____________________________________________________________
consensus TGAAGAAGTGGGCTTTGGTGCGAATGAGAGCGACACAGCGGACGCTATGGCCGCCATTTC
 
. : . : . : . : . : . :
JMSF050A11+ CAAATATCTATTCCCCGGAGAAGAAAGATCTGATAGAGATTTTGGGGTTTTTGGTGGTTT
                      ____________________________________________________________
consensus CAAATATCTATTCCCCGGAGAAGAAAGATCTGATAGAGATTTTGGGGTTTTTGGTGGTTT
 
. : . : . : . : . : . :
JMSF050A11+ CAGGTCATTTGGAAGCCTGGAAGTTCCCTTGTAATTCTGTGCACTGTACAGGAGAAAACG
                      ____________________________________________________________
consensus CAGGTCATTTGGAAGCCTGGAAGTTCCCTTGTAATTCTGTGCACTGTACAGGAGAAAACG
 
. : . : . : . : . : . :
JMSF050A11+ GAAAATCTGAGAGCGGATAAGTACGCAAAACTATGGCTGCTTCTGATTGGCCACCCGCAC
                      ____________________________________________________________
consensus GAAAATCTGAGAGCGGATAAGTACGCAAAACTATGGCTGCTTCTGATTGGCCACCCGCAC