Previous Contig 007962:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS016B08Sequence641007962 (8)gb:AY062680_15653366e-54Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS063F08Sequence641007962 (8)gb:AY062680_15653366e-54Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS092A08Sequence611007962 (8)gb:AY062680_15653363e-49Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS116E10Sequence574007962 (8)gb:AY062680_15653365e-47Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS140A12Sequence626007962 (8)gb:AY062680_15653361e-51Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF011L03Sequence367007962 (8)gb:AY062680_15653366e-19Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.737011643 (3)gb:AY062680_15653363e-58Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF050A03Sequence579007962 (8)gb:AY062680_15653364e-39Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.712024400gb:AY062680_15653367e-77Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF050A22Sequence615007962 (8)gb:AY062680_15653363e-47Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.725011643 (3)gb:AY050535_15622633e-62Arabidopsis thaliana leucine-rich repeat receptor-like kinase F21M12.36 mRNA, co

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS063F08+ TCCCTTCCAGGCTGCAATTCGATAAATACAGCCA
JMFS140A12+ AATTCGATAAATACAGCCA
JMFS092A08+ CAGCCA
JMFS016B08+ TCCCTTCCAGGCTGCAATTCGATAAATACAGCCA
                      ____________________________________________________________
consensus TCCCTTCCAGGCTGCAATTCGATAAATACAGCCA
 
. : . : . : . : . : . :
JMFS063F08+ ATTCAAATTCGTAAGCTTTACAATAAAATCCGGCAACGTTGTTCTGTCGAACGGATTGTC
JMFS140A12+ ATTCAAATTCGTAAGCTTTACAATAAAATCCGGCAACGTTGTTCTGTCGAACGGATTGTC
JMFS092A08+ ATTCAAATTCGTAAGCTTTACAATAAAATCCGGCAACGTTGTTCTGTCGAACGGATTGTC
JMFS116E10+ CGGCAACGTTGTTCTGTCGAACGGATTGTC
JMFS016B08+ ATTCAAATTCGTAAGCTTTACAATAAAATCCGGCAACGTTGTTCTGTCGAACGGATTGTC
JMSF050A22+ TAAGCTTTACAATAAAATCCGGCAACGTTGTTCTGTCGAACGGATTGTC
                      ____________________________________________________________
consensus ATTCAAATTCGTAAGCTTTACAATAAAATCCGGCAACGTTGTTCTGTCGAACGGATTGTC
 
. : . : . : . : . : . :
JMFS063F08+ CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
JMFS140A12+ CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
JMFS092A08+ CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
JMFS116E10+ CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
JMFS016B08+ CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
JMSF050A22+ CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
JMSF050A03+ CTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
                      ____________________________________________________________
consensus CCCGAGACTAAGAACCTCCAGCTTCGTCATATTTTCCAGCGAATTCCAGGGAAATTTTCC
 
. : . : . : . : . : . :
JMFS063F08+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
JMFS140A12+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
JMFS092A08+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
JMFS116E10+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
JMFS016B08+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
JMSF050A22+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
JMSF050A03+ GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
                      ____________________________________________________________
consensus GGTGAACCCACTGTTGTTCAAGTACAAATGCGTCATCTGAGTGAGCGAAGACATTCCCGG
 
. : . : . : . : . : . :
JMFS063F08+ AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
JMFS140A12+ AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
JMFS092A08+ AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
JMFS116E10+ AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
JMFS016B08+ AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
JMSF050A22+ AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
JMSF050A03+ AATCGNTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
                      ____________________________________________________________
consensus AATCGGTCCGGAGAATAAATTATTCCCAAGGTCTATATACGTCAGACTAACGCATTTATT
 
. : . : . : . : . : . :
JMFS063F08+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMFS140A12+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMFS092A08+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMFS116E10+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMFS016B08+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMSF050A22+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMSF011L03+ CCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
JMSF050A03+ CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
                      ____________________________________________________________
consensus CAAGCTGTCGGAGACTCCGCCGGAAAGTGAATTGAATCCCAGAGAGAGCTTTTCCAGAGA
 
. : . : . : . : . : . :
JMFS063F08+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMFS140A12+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMFS092A08+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMFS116E10+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMFS016B08+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMSF050A22+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMSF011L03+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
JMSF050A03+ TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAANTTC
                      ____________________________________________________________
consensus TTTAAGAGAGCAGATAGAATCGAAAGGGACAGAGCCAGAGAGGCCTCGGCGGGAAAGTTC
 
. : . : . : . : . : . :
JMFS063F08+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMFS140A12+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMFS092A08+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMFS116E10+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMFS016B08+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMSF050A22+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMSF011L03+ GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
JMSF050A03+ GATTTCTTTGANTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
                      ____________________________________________________________
consensus GATTTCTTTGACTGAGCCATTTGAATCGCACGTAACTCCGGGGAAATCGCAGGGAGAATG
 
. : . : . : . : . : . :
JMFS063F08+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMFS140A12+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMFS092A08+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMFS116E10+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMFS016B08+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMSF050A22+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMSF011L03+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
JMSF050A03+ ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
                      ____________________________________________________________
consensus ACGCGCGTTCCAGGTATCAAATATCTTGGTATCGGAGTTTTGAAGGGCCGCTTTAATGGC
 
. : . : . : . : . : . :
JMFS063F08+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMFS140A12+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMFS092A08+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMFS116E10+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMFS016B08+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMSF050A22+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMSF011L03+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
JMSF050A03+ GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
                      ____________________________________________________________
consensus GAGGAGAGACTCGAGCTCGGTGGCGGCGGCGGAGATGAATAGAAGGGATAGTATGGGTAG
 
. : . : . : . : . : . :
JMFS063F08+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMFS140A12+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMFS092A08+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMFS116E10+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMFS016B08+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMSF050A22+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMSF011L03+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
JMSF050A03+ AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
                      ____________________________________________________________
consensus AATGACGAGGATAAGGTTTGGCCGGAAAATATGAGGCGCCGCCATGGCTGACAATTGGAG
 
. : . : . : . : . : . :
JMFS063F08+ AATTGTC
JMFS140A12+ AATTGTC
JMFS092A08+ AATTG
JMFS116E10+ AATT
JMFS016B08+ AATTGTC
JMSF050A22+ AATTGTCTTCAGTTGAGAAGGGT
JMSF011L03+ AATTGTCTTCAGTTGAGAAGGGT
JMSF050A03+ AATTGTCTTCAGTTGAGAAGGGTGCGAGTGAAAACTGAAGACGANATCGCCGTTTTAACC
                      ____________________________________________________________
consensus AATTGTCTTCAGTTGAGAAGGGTGCGAGTGAAAACTGAAGACGANATCGCCGTTTTAACC