Previous Contig 007960:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017M17Sequence564007960 (5)gb:AF180733_17748252e-80Arabidopsis thaliana dynamin-like protein 4 (ADL4) mRNA, complete cds.783009029 (2)gb:AE016959_10238921e-47Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFF022F02Sequence555007960 (5)gb:AF180733_17748252e-53Arabidopsis thaliana dynamin-like protein 4 (ADL4) mRNA, complete cds.751003308 (3)gb:AE016959_10238925e-68Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFS126D06Sequence626007960 (5)gb:AF180733_17748254e-54Arabidopsis thaliana dynamin-like protein 4 (ADL4) mRNA, complete cds.
JMSF036L16Sequence691007960 (5)gb:ATH304842_1552441e-112Arabidopsis thaliana mRNA for dynamin-like protein ADLP2 (dlp2 gene).>gb:AF42833708023733gb:AE016959_10238926e-73Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMSF049P19Sequence431007960 (5)gb:AF180733_17748252e-10Arabidopsis thaliana dynamin-like protein 4 (ADL4) mRNA, complete cds.733009029 (2)gb:AE016959_10238921e-66Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036L16+ AGACTCCA
                      ____________________________________________________________
consensus AGACTCCA
 
. : . : . : . : . : . :
JMSF036L16+ AGTGCATTGAGAGAAGCTTTGCCAGATACTCCGAACCCATTTTACTGGCAAGGTGACTGT
                      ____________________________________________________________
consensus AGTGCATTGAGAGAAGCTTTGCCAGATACTCCGAACCCATTTTACTGGCAAGGTGACTGT
 
. : . : . : . : . : . :
JMSF036L16+ AGTCGGGGCTTGTAGCGAAATACTCACGCTCCCTTCTTCGTGCAGCAAGCATGTCGACAT
                      ____________________________________________________________
consensus AGTCGGGGCTTGTAGCGAAATACTCACGCTCCCTTCTTCGTGCAGCAAGCATGTCGACAT
 
. : . : . : . : . : . :
JMSF036L16+ TTTTGTTGATGTCAGCTTGTGAACGGTTAACAATACCCACCCAAGGTTGTTGCAACCGGT
                      ____________________________________________________________
consensus TTTTGTTGATGTCAGCTTGTGAACGGTTAACAATACCCACCCAAGGTTGTTGCAACCGGT
 
. : . : . : . : . : . :
JMSF036L16+ ACGATCTTCCTTCAAGAACATCCAATGCATTAGTTCCTTTATCCATCAAATCTAGCTTCG
                      ____________________________________________________________
consensus ACGATCTTCCTTCAAGAACATCCAATGCATTAGTTCCTTTATCCATCAAATCTAGCTTCG
 
. : . : . : . : . : . :
JMSF036L16+ TAAGGACCCCAAATGTACGCTCGCCTGCGGGATCTACTTCCCTTGAAAGTTTAATTGCAT
                      ____________________________________________________________
consensus TAAGGACCCCAAATGTACGCTCGCCTGCGGGATCTACTTCCCTTGAAAGTTTAATTGCAT
 
. : . : . : . : . : . :
JMSF036L16+ CTGATGTGGCAATATCCTGATTGGCTGGAGATATCGCAAGTATGATGCAGTTGGGTTTCT
JMFF017M17+ GGAGATATTGCTAGTATAATGCAGTTGGGCTTCC
                      ____________________________________________________________
consensus CTGATGTGGCAATATCCTGATTGGCTGGAGATATTGCTAGTATGATGCAGTTGGGTTTCT
 
. : . : . : . : . : . :
JMSF036L16+ CCACATAGGATCGGACCATGTCTTCAATGTCTTTGACTACACTTTCAGGTTGCCCCTCAA
JMFF017M17+ CAACATAGGTTCGGACCATGTTTTCAATATCTTCAACTATACTTTCAGGTTGCCCCTCAA
                      ____________________________________________________________
consensus CCACATAGGTTCGGACCATGTTTTCAATGTCTTTGACTATACTTTCAGGTTGCCCCTCAA
 
. : . : . : . : . : . :
JMSF036L16+ CAGCAACTTTTGTCAAACCGGGCAAATCAATTAGCGTGAGGTTGACGACATTGGGGGAAT
JMFF017M17+ CAGCAACTTTTGTCAAACCAGGCAAATCAATCAGTGTTAAGTTGACCACATTGGGGGAGT
JMFS126D06+ ACATTGGGGGAAT
                      ____________________________________________________________
consensus CAGCAACTTTTGTCAAACCGGGCAAATCAATTAGTGTTAGGTTGACGACATTGGGGGAAT
 
. : . : . : . : . : . :
JMSF036L16+ AGATGCTGAGGTGAATAGGAACTGGAGATATTTGTTTGGTTTTTCCCGTGATTCTGTCAG
JMFF017M17+ AGATGCTGAGGTGGATGGGAACAGGAGAAATTTGTTTTGATTTTCCAGTGATTCTATCAG
JMFS126D06+ AGATGCTGAGGTGAATAGGAACTGGAGATATTTGTTTGGTTTTTCCCGTGATTCTGTCAG
JMFF022F02+ ATGCTGAGGTGGATGGGAACAGGAGAAATCTGTTTTGTTTTCCCTGTTAGTCTATCAG
                      ____________________________________________________________
consensus AGATGCTGAGGTGGATGGGAACTGGAGATATTTGTTTTGTTTTTCCCGTGATTCTGTCAG
 
. : . : . : . : . : . :
JMSF036L16+ TTTCATCCTGAATTTCCTTGCGAACCAGAGAGAAATCAGTGAAACGCCTTCGTGGCAAAT
JMFF017M17+ TTTCATCCTGAATTTCCTTGCGTACCAGAGCGAAGTCTGTGAATCTTTTTCGTGGCAAGT
JMFS126D06+ TTTCATCCTGAATTTCCTTGCGAACCAGAGAGAAATCAGTGAAACGCCTTCGTGGCAAAT
JMFF022F02+ TTTCATCCTGAATTTCTTTGCGAACTAGGGAGAAATCACTGAACCGTCTTCTTGGTAAAT
                      ____________________________________________________________
consensus TTTCATCCTGAATTTCCTTGCGAACCAGAGAGAAATCAGTGAAACGTCTTCGTGGCAAAT
 
. : . : . : . : . : . :
JMSF036L16+ GACCGAATTCTGCATATTCCTCCTGCCCTTCATCAATCTTCTGCAGCTGCAACACCAATG
JMFF017M17+ GAGCAAACTCTGCATATTCCGGCTGCCCAGCATCTGTCTTGTGCAACTGCAATACCAATG
JMFS126D06+ GACCGAATTCTGCATATTCCTCCTGCCCTTCATCAATCTTCTGCAGCTGCAACACCAATG
JMFF022F02+ GAGCGAATTCTGCATACTCCTCCTGCCCATCGTTTGTCTTGTGCAACTGTAACACCAAAG
                      ____________________________________________________________
consensus GAGCGAATTCTGCATATTCCTCCTGCCCTTCATCTGTCTTGTGCAGCTGCAACACCAATG
 
. : . : . : . : . : . :
JMSF036L16+ GCCGTCTTGTAACAATCCCAGAT
JMFF017M17+ GCCGCCTTGTGACAATCCCAGATCCTCGAGGAAGAAAATCTCTCCCAACTACGCTTTCCA
JMFS126D06+ GCCGTCTTGTAACAATCCCAGATCCTCGAGGAAGAAAATCTCTCCCAACTATGCTTTCCA
JMFF022F02+ GCCGCCTCGTAACAATCCCGGACCCTCGGGGAAGAAAATCCCGTCCAACTACGCTTTCCA
JMSF049P19+ GCTTTCCA
                      ____________________________________________________________
consensus GCCGTCTTGTAACAATCCCAGATCCTCGAGGAAGAAAATCTCTCCCAACTACGCTTTCCA
 
. : . : . : . : . : . :
JMFF017M17+ ACACCGATGATTTTCCAGAACTCTGACCACCGACGACGGCGACGGAGGGAAGAGCGTCCC
JMFS126D06+ ACACAGAAGATTTTCCAGAACTCTGACCGCCAACGACGGCGACGGAGGGCAGAGCATCCC
JMFF022F02+ GCACAGAAGATTTTCCAGAACTCTGACCGCCGACGACGGCGACGGACGGAAGTGCGTCCC
JMSF049P19+ ACNCCGATGATTTTCCAGAACTNTGACCNCCGACGACGGCGACGGAGGGAAGAGCGTCCC
                      ____________________________________________________________
consensus ACACCGATGATTTTCCAGAACTCTGACCGCCGACGACGGCGACGGAGGGAAGAGCGTCCC
 
. : . : . : . : . : . :
JMFF017M17+ AGAGAGAAGAGAAAGCGTTGTCACCCCCACCGTAGTCGCCGAGAGCCGTACAAGCTCTCT
JMFS126D06+ AAAGAGAAGAGAAAGCGTTGTCGCCGCCGCCGTGGTCGCCGAGAGCAGTACAGGCTCTCT
JMFF022F02+ AGAGAGAAGAGAAAGAGTTGTCGTCGCCACCGTAGTCGCCGAGAGCAGTACAAGCTCTCT
JMSF049P19+ AGAGAGAAGAGAAAGCGTTGTCNCCCCCNCCGTAGTCGCCGAGAGCCGTACAAGCTCTNT
                      ____________________________________________________________
consensus AGAGAGAAGAGAAAGCGTTGTCGCCGCCACCGTAGTCGCCGAGAGCCGTACAAGCTCTCT
 
. : . : . : . : . : . :
JMFF017M17+ GAAT
JMFS126D06+ GAAT
JMFF022F02+ GAATACGATTTACCAAACCTATCAAGCTCTCCATCGTCG
JMSF049P19+ GAATCCGATTCACCAAACCGATCAAGCTNTCCATTGTCGACATNTTCTCACCCTCACAAA
                      ____________________________________________________________
consensus GAATCCGATTTACCAAACCTATCAAGCTCTCCATTGTCGACATNTTCTCACCCTCACAAA
 
. : . : . : . : . : . :
JMSF049P19+ AACNCTAATGCCTAACCAGATNTGATGCTCAGCTCCAAAAATTCNCNCAAATTTTTGGAG
                      ____________________________________________________________
consensus AACNCTAATGCCTAACCAGATNTGATGCTCAGCTCCAAAAATTCNCNCAAATTTTTGGAG
 
. : . : . : . : . : . :
JMSF049P19+ GAAAAAAAAAATCTGAAAATAATAATTTAGGCAATGAAGATCTGAAGGTGGAAAGACGAG
                      ____________________________________________________________
consensus GAAAAAAAAAATCTGAAAATAATAATTTAGGCAATGAAGATCTGAAGGTGGAAAGACGAG
 
. : . : . : . : . : . :
JMSF049P19+ GGAAAGGTTTTGAAGTTGGCGACTTTGTGGACTTGGATTGAATGCGAAGTGAAAAAACGA
                      ____________________________________________________________
consensus GGAAAGGTTTTGAAGTTGGCGACTTTGTGGACTTGGATTGAATGCGAAGTGAAAAAACGA
 
. : . : . : . : . : . :
JMSF049P19+ TGTTTTAGGGAGACAAAACTCTGAGCTTGTTGGACTGTTTTTGTTCAAATTTCAATTCAA
                      ____________________________________________________________
consensus TGTTTTAGGGAGACAAAACTCTGAGCTTGTTGGACTGTTTTTGTTCAAATTTCAATTCAA