Previous Contig 007959:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021G09Sequence656007959 (8)gb:AY085825_15708903e-48Arabidopsis thaliana clone 18715 mRNA, complete sequence.712007959 (8)gb:AY085825_15708904e-48Arabidopsis thaliana clone 18715 mRNA, complete sequence.
JMSF024M13Sequence313007959 (8)265007959 (8)
JMSF027C13Sequence290007959 (8)772013325 (11)pir|D96670|D966705e-84probable membrane related protein F13O11.4 [imported] - Arabidopsis thaliana>gb:
JMSF049P18Sequence416007959 (8)gb:AY085825_15708901e-48Arabidopsis thaliana clone 18715 mRNA, complete sequence.756024398gb:AY235681_15919891e-50Lycopersicon esculentum P58IPK mRNA, complete cds.
JMSF050G09Sequence650007959 (8)gb:AY085825_15708903e-48Arabidopsis thaliana clone 18715 mRNA, complete sequence.697007959 (8)gb:AY085825_15708904e-48Arabidopsis thaliana clone 18715 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024M13+ TTTTTTTTTTATAAGG
rJMSF021G09- ATAAGG
                      ____________________________________________________________
consensus TTTTTTTTTTATAAGG
 
. : . : . : . : . : . :
JMSF027C13+ AAATGATTCTTTACAAATTTAAAGGCTGCTTGCCA
rJMSF024M13- AATTTAAAGGCTGCTTGCCA
JMSF024M13+ AAAGCAACACCACATATATGTTCCAAAATGATTCTTTACAAATTTAAAGGCTGCTTGCCA
rJMSF050G09- ACACCACATATATGTTCC-AAATGATTCTTTACAAATTTAAAGGCTGCTTGCCA
JMSF050G09+ AAGGCTGCTTGCCA
rJMSF021G09- AAAGCAACACCACATATATGTTCCAAAATGATTCTTTACAAATTTAAAGGCTGCTTGCCA
JMSF021G09+ AAAGGCTGCTTGCCA
                      ____________________________________________________________
consensus AAAGCAACACCACATATATGTTCCAAAATGATTCTTTACAAATTTAAAGGCTGCTTGCCA
 
. : . : . : . : . : . :
JMSF027C13+ AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
rJMSF024M13- AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
JMSF024M13+ AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
rJMSF050G09- AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
JMSF050G09+ AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
rJMSF021G09- AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
JMSF021G09+ AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
                      ____________________________________________________________
consensus AATATCATTCAAGGAACCTTTTTAAGTTTAAACCAATGACTACCAAGGAAAGAAAATCTA
 
. : . : . : . : . : . :
JMSF027C13+ GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
rJMSF024M13- GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
JMSF024M13+ GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
rJMSF050G09- GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
JMSF050G09+ GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
rJMSF021G09- GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
JMSF021G09+ GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
                      ____________________________________________________________
consensus GTTAAACCACAAGTGCAAAAGCTGCCTCAACAGCAAACCAGTTAAGTATCAACTCTGTGA
 
. : . : . : . : . : . :
JMSF027C13+ TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
rJMSF024M13- TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
JMSF024M13+ TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
rJMSF050G09- TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
JMSF050G09+ TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
rJMSF021G09- TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
JMSF021G09+ TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
                      ____________________________________________________________
consensus TTTTATTAATTTGTGAAAGTCGAAATATAACTTCACTGGGGAAAACGGGGAAAACACTAA
 
. : . : . : . : . : . :
JMSF027C13+ ACATGGATCGGAA-TTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTT
rJMSF024M13- ACATGGATCGGAA-TTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTT
JMSF024M13+ ACATGGATCGGAA-TTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTT
rJMSF050G09- ACATGGATCGGAATTTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTTCC
JMSF050G09+ ACATGGATCGGAATTTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTTCC
rJMSF021G09- ACATGGATCGGAA-TTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTTCC
JMSF021G09+ ACATGGATCGGAA-TTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTTCC
                      ____________________________________________________________
consensus ACATGGATCGGAA-TTTTCTTCCAGTGCACGGGTACCTCCTCAAATCTTAAATCATTTCC
 
. : . : . : . : . : . :
rJMSF050G09- TCGAGAAAGGATCAACCTTAATCATTGTCTTCCTTGCCATAGTTATATATTATCTCAATC
JMSF050G09+ TCGAGAAAGGATCAACCTTAATCATTGTCTTCCTTGCCATAGTTATATATTATCTCAATC
rJMSF021G09- TCGAGAAAGGATCAACCTTAATCATTGTCTTCCTTGCCATAGTTATATATTATCTCAATC
JMSF021G09+ TCGAGAAAGGATCAACCTTAATCATTGTCTTCCTTGCCATAGTTATATATTATCTCAATC
JMSF049P18+ GAAAGGATCAACCTTAATCATTGTCTTCCTTGCCATAGTTATATATTATCTCAATC
                      ____________________________________________________________
consensus TCGAGAAAGGATCAACCTTAATCATTGTCTTCCTTGCCATAGTTATATATTATCTCAATC
 
. : . : . : . : . : . :
rJMSF050G09- CCAGCAGGCGGCACTGGATTTCGGTTAAACTTGCTACCACCAGGAGCCCATGGAACAATA
JMSF050G09+ CCAGCAGGCGGCACTGGATTTCGGTTAAACTTGCTACCACCAGGAGCCCATGGAACAATA
rJMSF021G09- CCAGCAGGCGGCACTGGATTTCGGTTAAACTTGCTACCACCAGGAGCCCATGGAACAATA
JMSF021G09+ CCAGCAGGCGGCACTGGATTTCGGTTAAACTTGCTACCACCAGGAGCCCATGGAACAATA
JMSF049P18+ CCAGCAGGCGGCACTGGATTTCGGTTAAACTTGCTACCACCAGGAGCCCATGGAACAATA
                      ____________________________________________________________
consensus CCAGCAGGCGGCACTGGATTTCGGTTAAACTTGCTACCACCAGGAGCCCATGGAACAATA
 
. : . : . : . : . : . :
rJMSF050G09- TAAGGATCAGGATGCCGCCACTTATTATAAGTAGCTTCACCATCGTCTATCATTCTATCA
JMSF050G09+ TAAGGATCAGGATGCCGCCACTTATTATAAGTAGCTTCACCATCGTCTATCATTCTATCA
rJMSF021G09- TAAGGATCAGGATGCCGCCACTTATTATAAGTAGCTTCACCATCGTCTATCATTCTATCA
JMSF021G09+ TAAGGATCAGGATGCCGCCACTTATTATAAGTAGCTTCACCATCGTCTATCATTCTATCA
JMSF049P18+ TAAGGATCAGGATGCCGCCACTTATTATAAGTAGCTTCACCATCGTCTATCATTCTATCA
                      ____________________________________________________________
consensus TAAGGATCAGGATGCCGCCACTTATTATAAGTAGCTTCACCATCGTCTATCATTCTATCA
 
. : . : . : . : . : . :
rJMSF050G09- ATTGTTTCAACATCTTCCACGTGTTTGTTAGCGTCGAACCTCTCCCTGAGAGCATCGGCA
JMSF050G09+ ATTGTTTCAACATCTTCCACGTGTTTGTTAGCGTCGAACCTCTCCCTGAGAGCATCGGCA
rJMSF021G09- ATTGTTTCAACATCTTCCACGTGTTTGTTAGCGTCGAACCTCTCCCTGAGAGCATCGGCA
JMSF021G09+ ATTGTTTCAACATCTTCCACGTGTTTGTTAGCGTCGAACCTCTCCCTGAGAGCATCGGCA
JMSF049P18+ ATTGTTTCAACATCTTCCACGTGTTTGTTAGCGTCGAACCTCTCCCTGAGAGCATCGGCA
                      ____________________________________________________________
consensus ATTGTTTCAACATCTTCCACGTGTTTGTTAGCGTCGAACCTCTCCCTGAGAGCATCGGCA
 
. : . : . : . : . : . :
rJMSF050G09- TCGGGATAGAAGAGGTGGCGATGGACCGCCCAGGTGAGAGTGTCTTTCAAGGCGCGGCGG
JMSF050G09+ TCGGGATAGAAGAGGTGGCGATGGACCGCCCAGGTGAGAGTGTCTTTCAAGGCGCGGCGG
rJMSF021G09- TCGGGATAGAAGAGGTGGCGATGGACCGCCCAGGTGAGAGTGTCTTTCAAGGCGCGGCGG
JMSF021G09+ TCGGGATAGAAGAGGTGGCGATGGACCGCCCAGGTGAGAGTGTCTTTCAAGGCGCGGCGG
JMSF049P18+ TCGGGATAGAAGAGGTGGCGATGGACCGCCCAGGTGAGAGTGTCTTTCAAGGCGCGGCGG
                      ____________________________________________________________
consensus TCGGGATAGAAGAGGTGGCGATGGACCGCCCAGGTGAGAGTGTCTTTCAAGGCGCGGCGG
 
. : . : . : . : . : . :
rJMSF050G09- TAGAGAATCCGCACTCTCTCCTTCTGCGCTGCTCTCCGAGCTAGAAACGACACTGATGCT
JMSF050G09+ TAGAGAATCCGCACTCTCTCCTTCTGCGCTGCTCTCCGAGCTAGAAACGACACTGATGCT
rJMSF021G09- TAGAGAATCCGCACTCTCTCCTTCTGCGCTGCTCTCCGAGCTAGAAACGACACTGATGCT
JMSF021G09+ TAGAGAATCCGCACTCTCTCCTTCTGCGCTGCTCTCCGAGCTAGAAACGACACTGATGCT
JMSF049P18+ TAGAGAATCCGCACTCTCTCCTTCTGCGCTGCTCTCCGAGCTAGAAACGACACTGATGCT
                      ____________________________________________________________
consensus TAGAGAATCCGCACTCTCTCCTTCTGCGCTGCTCTCCGAGCTAGAAACGACACTGATGCT
 
. : . : . : . : . : . :
rJMSF050G09- ACAGCTCCACTCATCTCTCTCTCTTTCTCTCTTC
JMSF050G09+ ACAGCTCCACTCATCTCTCTCTCTTTCTCTCTTC
rJMSF021G09- ACAGCTCCACTCATCTCTCTCTCTTTCTCTCTTC
JMSF021G09+ ACAGCTCCACTCATCTCTCTCTCTTTCTCTCTTC
JMSF049P18+ ACAGCTCCACTCATCTCTCTCTCTTTCTCTCTTCGCCTGTTACTCTCTTCTCTCTACCCA
                      ____________________________________________________________
consensus ACAGCTCCACTCATCTCTCTCTCTTTCTCTCTTCGCCTGTTACTCTCTTCTCTCTACCCA