Previous Contig 007954:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001G16Sequence608007954 (5)gb:BT004563_16375973e-22Arabidopsis thaliana At2g18100 gene, complete cds.769010525 (6)pir|C84560|C845605e-65hypothetical protein At2g18100 [imported] - Arabidopsis thaliana>gb:AC006201_153
JMFF001K22Sequence584007954 (5)gb:BT004563_16375975e-18Arabidopsis thaliana At2g18100 gene, complete cds.545010525 (6)gb:BT004563_16375971e-28Arabidopsis thaliana At2g18100 gene, complete cds.
JMFF045F11Sequence646007954 (5)gb:BT004563_16375973e-24Arabidopsis thaliana At2g18100 gene, complete cds.628010525 (6)gb:BT004563_16375973e-33Arabidopsis thaliana At2g18100 gene, complete cds.
JMSF046A02Sequence682007954 (5)gb:BT004563_16375976e-26Arabidopsis thaliana At2g18100 gene, complete cds.832010525 (6)pir|C84560|C845606e-65hypothetical protein At2g18100 [imported] - Arabidopsis thaliana>gb:AC006201_153
JMSF049O20Sequence679007954 (5)gb:BT004563_16375976e-26Arabidopsis thaliana At2g18100 gene, complete cds.784010525 (6)pir|C84560|C845606e-67hypothetical protein At2g18100 [imported] - Arabidopsis thaliana>gb:AC006201_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046A02+ TCCGGTTGATTTTCAACATGAGTAGCTTCCCCTTCAGG
JMSF049O20+ GAGTAGCTTCCCCTTCAGG
                      ____________________________________________________________
consensus TCCGGTTGATTTTCAACATGAGTAGCTTCCCCTTCAGG
 
. : . : . : . : . : . :
JMSF046A02+ ATTTGACTCTGAGTCAGCAGTTGAGAATTTCTCTCTGCATTCATTCTCATATTCACGCAG
JMFF045F11+ TCAGCAGTTGAGAATTTCTCTCTGCATTCATTCTCATATTCACGCAG
JMFF001G16+ TGCATTCATTCTCATATTCACGCAG
JMSF049O20+ ATTTGACTCTGAGTCAGCAGTTGAGAATTTCTCTCTGCATTCATTCTCATATTCACGCAG
                      ____________________________________________________________
consensus ATTTGACTCTGAGTCAGCAGTTGAGAATTTCTCTCTGCATTCATTCTCATATTCACGCAG
 
. : . : . : . : . : . :
JMSF046A02+ CTTCTCCTTCTCAGATTCAAGATCAACAGTTTTCTCTATGCTTGATGCCATAGAATCTAT
JMFF045F11+ CTTCTCCTTCTCAGATTCAAGATCAACAGTTTTCTCTATGCTGNATGCCATAGAATCTAT
JMFF001G16+ CTTCTCCTTCTCAGATTCAAGATCAACAGTTTTCTCTATGCTTGATGCCATAGAATCTAT
JMFF001K22+ TTCAAGATCAACAGTTTTCTCTATGCTTGATGCCATAGAATCTAT
JMSF049O20+ CTTCTCCTTCTCAGATTCAAGATCAACAGTTTTCTCTATGCTTGATGCCATAGAATCTAT
                      ____________________________________________________________
consensus CTTCTCCTTCTCAGATTCAAGATCAACAGTTTTCTCTATGCTTGATGCCATAGAATCTAT
 
. : . : . : . : . : . :
JMSF046A02+ ACTGTTTGCCAAAGTAATTTCCCTTTCCAGTACTTCAGAAGAAGCATCCCCACTTCCCTC
JMFF045F11+ ACTGTTTGCCAAAGTAATTTCCCTTTCCAGTACTTCAGAAGAAGCATCCCCACTTCCCTC
JMFF001G16+ ACTGTTTGCCAAAGTAATTTCCCTTTCCAGTACTTCAGAAGAAGCATCCCCACTTCCCTC
JMFF001K22+ ACTGTTTGCCAAAGTAATTTCCCTTTCCAGTACTTCAGAAGAAGCATCCCCACTTCCCTC
JMSF049O20+ ACTGTTTGCCAAAGTAATTTCCCTTTCCAGTACTTCAGAAGAAGCATCCCCACTTCCCTC
                      ____________________________________________________________
consensus ACTGTTTGCCAAAGTAATTTCCCTTTCCAGTACTTCAGAAGAAGCATCCCCACTTCCCTC
 
. : . : . : . : . : . :
JMSF046A02+ AGAGAGTAACCTGAGAAACGCTCCCACATGACGATTGGCCGGTCCATTACCGGCAGTTTC
JMFF045F11+ AGAGAGTAACCTGAGAAACGCTCCCACATGACGATTGGCCGGTCCATTACCGGCAGTTTC
JMFF001G16+ AGAGAGTAACCTGAGAAACGCTCCCACATGACGATTGGCCGGTCCATTACCGGCAGTTTC
JMFF001K22+ AGAGAGTAACCTGAGAAACGCTCCCACATGACGATTGGCCGGTCCATTACCGGCAGTTTC
JMSF049O20+ AGAGAGTAACCTGAGAAACGCTCCCACATGACGATTGGCCGGTCCATTACCGGCAGTTTC
                      ____________________________________________________________
consensus AGAGAGTAACCTGAGAAACGCTCCCACATGACGATTGGCCGGTCCATTACCGGCAGTTTC
 
. : . : . : . : . : . :
JMSF046A02+ CTCAAGTCCAGTCCATGCTATAGGATCGATCTCTAGAAACTTGAAGACAGGACGGAGGAG
JMFF045F11+ CTCAAGTCCAGTCCATGCTATAGGATCGATCTCTAGAAACTTGAAGACAGGACGGAGGAG
JMFF001G16+ CTCAAGTCCAGTCCATGCTATAGGATCGATCTCTAGAAACTTGAAGACAGGACGGAGGAG
JMFF001K22+ CTCAAGTCCAGTCCATGCTATAGGATCGATCTCTAGAAACTTGAAGACAGGACGGAGGAG
JMSF049O20+ CTCAAGTCCAGTCCATGCTATAGGATCGATCTCTAGAAACTTGAAGACAGGACGGAGGAG
                      ____________________________________________________________
consensus CTCAAGTCCAGTCCATGCTATAGGATCGATCTCTAGAAACTTGAAGACAGGACGGAGGAG
 
. : . : . : . : . : . :
JMSF046A02+ AGAGGATGACTGGTGCACCCAAAGCTGTGGGTCTTCGGAGACGGAATCGCTGCTGCTGCT
JMFF045F11+ AGAGGATGACTGGTGCACCCAAAGCTGTGGGTCTTCGGAGACGGAATCGCTGCTGCTGCT
JMFF001G16+ AGAGGATGACTGGTGCACCCAAAGCTGTGGGTCTTCGGAGACGGAATCGCTGCTGCTGCT
JMFF001K22+ AGAGGATGACTGGTGCACCCAAAGCTGTGGGTCTTCGGAGACGGAATCGCTGCTGCTGCT
JMSF049O20+ AGAGGATGACTGGTGCACCCAAAGCTGTGGGTCTTCGGAGACGGAATCGCTGCTGCTGCT
                      ____________________________________________________________
consensus AGAGGATGACTGGTGCACCCAAAGCTGTGGGTCTTCGGAGACGGAATCGCTGCTGCTGCT
 
. : . : . : . : . : . :
JMSF046A02+ GCTACCACTGCTGATGCGATCCTGGGTTAGGTCTTCGTTGCCATCGGAGGGAACCCCCAA
JMFF045F11+ GCTACCACTGCTGATGCGATCCTGGGTTAGGTCTTCGTTGCCATCGGAGGGAACCCCCAA
JMFF001G16+ GCTACCACTGCTGATGCGATCCTGGGTTAGGTCTTCGTTGCCATCGGAGGGAACCCCCAA
JMFF001K22+ GCTACCACTGCTGATGCGATCCTGGGTTAGGTCTTCGTTGCCATCGGAGGGAACCCCCAA
JMSF049O20+ GCTACCACTGCTGATGCGATCCTGGGTTAGGTCTTCGTTGCCATCGGAGGGAACCCCCAA
                      ____________________________________________________________
consensus GCTACCACTGCTGATGCGATCCTGGGTTAGGTCTTCGTTGCCATCGGAGGGAACCCCCAA
 
. : . : . : . : . : . :
JMSF046A02+ AGGACGGGTCTGGTGGATCTGGGCCTGGTAAAGGGCCAACCCGAGAAGGGCGGCGGCGGC
JMFF045F11+ AGGACGGGTCTGGTGGATCTGGGCCTGGTAAAGGGCCAACCCGAGAAGGGCGGCGGCGGC
JMFF001G16+ AGGACGGGTCTGGTGGATCTGGGCCTGGTAAAGGGCCAACCCGAGAAGGGCGGCGGCGGC
JMFF001K22+ AGGACGGGTCTGGTGGATCTGGGCCTGGTAAAGGGCCAACCCGAGAAGGGCGGCGGCGGC
JMSF049O20+ AGGACGGGTCTGGTGGATCTGGGCCTGGTAAAGGGCCAACCCGAGAAGGGCGGCGGCGGC
                      ____________________________________________________________
consensus AGGACGGGTCTGGTGGATCTGGGCCTGGTAAAGGGCCAACCCGAGAAGGGCGGCGGCGGC
 
. : . : . : . : . : . :
JMSF046A02+ GTACCTCTGAGTCGGCGCGAGTATCGATGAAGGCGACGACGACATTGAATTTCATTCAAC
JMFF045F11+ GTACCTCTGAGTCGGCGCGAGTATCGATGAAGGCGACGACGACATTGAATTTCATTCAAC
JMFF001G16+ GTACCTCTGAGTCGGCGCGAGTATCGATGAAGG---CGACGACATTGAATTTCATTCAAC
JMFF001K22+ GTACCTCTGAGTCGGCGCGAGTATCGATGAAGGCGACGACGACATTGAATTTCATTCAAC
JMSF049O20+ GTACCTCTGAGTCGGCGCGAGTATCGATGAAGGCGACGACGACATTGAATTTCATTCAAC
                      ____________________________________________________________
consensus GTACCTCTGAGTCGGCGCGAGTATCGATGAAGGCGACGACGACATTGAATTTCATTCAAC
 
. : . : . : . : . : . :
JMSF046A02+ GGAAAGCAATCGCTAAAATCAGAGTGTCCAATTCCGAATCAATCAAACGAATTTCTGTTG
JMFF045F11+ GGAAAGCAATCGCTAAAATCAGAGTGTCCAATTCCGAATCAATCAAACGAATTTCTGTTG
JMFF001G16+ GGAAAGCAATCGCTAAAATCAGAGTGTCCAATTCCGAATCAATCAAACGAATTTCTGTTG
JMFF001K22+ GGAAAGCAATCGCTAAAATCAGAGTGTCCAATTCCGAATCAATCAAACGAATTTCTGTTG
JMSF049O20+ GGAAAGCAATCGCTAAAATCAGAGTGTCCAATTCCGAATCAATCAAACGAATTTCTGTTG
                      ____________________________________________________________
consensus GGAAAGCAATCGCTAAAATCAGAGTGTCCAATTCCGAATCAATCAAACGAATTTCTGTTG
 
. : . : . : . : . : . :
JMSF046A02+ TTTTCTTTGTAGCTACACTGCTCTCAGCTCATTCAAAACTCTC
JMFF045F11+ TTTTCTTTGTAGCTACACTGCTCTCAGCTCATTCAAAACTCTCGTTAAATCTTCTTCT
JMFF001G16+ TTTTCTTTGTAGCTACACTGCTCTCAGCTCATTCAAAACTCTCGTT
JMFF001K22+ TTTTCTTTGTAGCTACACTGCTCTCAGCTCATTCAAAACTCTCGTTAAATCTTCTTCT
JMSF049O20+ TTTTCTTTGTAGCTACACTGCTCTCAGCTCATTCAAAACTCTCGTTAAATCTTCTTCTCC
                      ____________________________________________________________
consensus TTTTCTTTGTAGCTACACTGCTCTCAGCTCATTCAAAACTCTCGTTAAATCTTCTTCTCC