Previous Contig 007951:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015F13Sequence606007951 (4)gb:AY085075_15701571e-78Arabidopsis thaliana clone 126533 mRNA, complete sequence.719008916 (4)gb:AB026632_15170183e-90Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15L12.>gb:AY045584_15
JMFF022I07Sequence316007951 (4)gb:AY085075_15701571e-34Arabidopsis thaliana clone 126533 mRNA, complete sequence.696008916 (4)gb:AB026632_15170182e-83Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15L12.>gb:AY045584_15
JMSF032K11Sequence720007951 (4)gb:AY085075_15701572e-84Arabidopsis thaliana clone 126533 mRNA, complete sequence.800008916 (4)gb:AB026632_15170181e-95Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15L12.>gb:AY045584_15
JMSF049O01Sequence666007951 (4)gb:AY085075_15701576e-76Arabidopsis thaliana clone 126533 mRNA, complete sequence.720008916 (4)gb:AB026632_15170181e-91Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15L12.>gb:AY045584_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032K11+ TGATCAGCAAGTAGCTGCAGAAG
                      ____________________________________________________________
consensus TGATCAGCAAGTAGCTGCAGAAG
 
. : . : . : . : . : . :
JMSF032K11+ AAGGGAATGATGCCTATTGGCATTACTGTTTATCTTTTCACTAGACTTCCCATCACTGGG
                      ____________________________________________________________
consensus AAGGGAATGATGCCTATTGGCATTACTGTTTATCTTTTCACTAGACTTCCCATCACTGGG
 
. : . : . : . : . : . :
JMSF032K11+ AGCCCCATTTTCAACTGAATCAGCAGCTGGTTTACTGAGCTCCGCCTTAATTGATGTAGC
JMFF015F13+ CTGAGCTCCGCCTTAATTGATGTAGC
JMSF049O01+ TGTAGC
                      ____________________________________________________________
consensus AGCCCCATTTTCAACTGAATCAGCAGCTGGTTTACTGAGCTCCGCCTTAATTGATGTAGC
 
. : . : . : . : . : . :
JMSF032K11+ CAGCATTGGAAGAAGATGACTCTGTGTGTTCACTTTAAATCCATCATTAACTCCCCTGTC
JMFF015F13+ CAGCATTGGAAGAAGATGACTCTGTGTGTTCACTTTAAATCCATCATTAACTCCCCTGTC
JMSF049O01+ CAGCATTGGAAGAAGATGACTCTGTGTGTTCACTTTAAATCCATCATTAACTCCCCTGTC
                      ____________________________________________________________
consensus CAGCATTGGAAGAAGATGACTCTGTGTGTTCACTTTAAATCCATCATTAACTCCCCTGTC
 
. : . : . : . : . : . :
JMSF032K11+ CAAGTGTATTGCCAAAGTTGGGATTCTCATTATAGGCTCCTGAATTCTCACCAGCCGCTG
JMFF015F13+ CAAGTGTATTGCCAAAGTTGGGATTCTCATTATAGGCTCCTGAATTCTCACCAGCCGCTG
JMSF049O01+ CAAGTGTATTGCCAAAGTTGGGATTCTCATTATAGGCTCCTGAATTCTCACCAGCCGCTG
                      ____________________________________________________________
consensus CAAGTGTATTGCCAAAGTTGGGATTCTCATTATAGGCTCCTGAATTCTCACCAGCCGCTG
 
. : . : . : . : . : . :
JMSF032K11+ TGCATAGGACTCTGACCCGTCTTTCCCTTCTCTTACTATTATCCTCCCAGCAACAGATAA
JMFF015F13+ TGCATAGGACTCTGACCCGTCTTTCCCTTCTCTTACTATTATCCTCCCAGCAACAGATAA
JMSF049O01+ TGCATAGGACTCTGACCCGTCTTTCCCTTCTCTTACTATTATCCTCCCAGCAACAGATAA
                      ____________________________________________________________
consensus TGCATAGGACTCTGACCCGTCTTTCCCTTCTCTTACTATTATCCTCCCAGCAACAGATAA
 
. : . : . : . : . : . :
JMSF032K11+ ATCACGATCAAACCACGTATGCCAGAGACCACCTCCATATGTTTGTACACCAACTTCTAG
JMFF015F13+ ATCACGATCAAACCACGTATGCCAGAGACCACCTCCATATGTTTGTACACCAACTTCTAG
JMSF049O01+ ATCACGATCAAACCACGTATGCCAGAGACCACCTCCATATGTTTGTACACCAACTTCTAG
                      ____________________________________________________________
consensus ATCACGATCAAACCACGTATGCCAGAGACCACCTCCATATGTTTGTACACCAACTTCTAG
 
. : . : . : . : . : . :
JMSF032K11+ ATAACCACCTTTACATACCTTTGTAGTTGGCTTTAGTTTCAAGCAGGGGCTATCAGTATG
JMFF022I07+ TTGTAGTTGGCTTTAGTTTCAAGCAGGGGCTATCAGTATG
JMFF015F13+ ATAACCACCTTTACATACCTTTGTAGTTGGCTTTAGTTTCAAGCAGGGGCTATCAGTATG
JMSF049O01+ ATAACCACCTTTACATACCTTTGTAGTTGGCTTTAGTTTCAAGCAGGGGCTATCAGTATG
                      ____________________________________________________________
consensus ATAACCACCTTTACATACCTTTGTAGTTGGCTTTAGTTTCAAGCAGGGGCTATCAGTATG
 
. : . : . : . : . : . :
JMSF032K11+ AGCTCCAAGAATATAGAACCCATTTCCAGCAACATATTTTTGGCCAATAGCAAAGGCAAC
JMFF022I07+ AGCTCCAAGAATATAGAACCCATTTCCAGCAACATATTTTTGGCCAATAGCAAAGGCAAC
JMFF015F13+ AGCTCCAAGAATATAGAACCCATTTCCAGCAACATATTTTTGGCCAATAGCAAAGGCAAC
JMSF049O01+ AGCTCCAAGAATATAGAACCCATTTCCAGCAACATATTTTTGGCCAATAGCAAAGGCAAC
                      ____________________________________________________________
consensus AGCTCCAAGAATATAGAACCCATTTCCAGCAACATATTTTTGGCCAATAGCAAAGGCAAC
 
. : . : . : . : . : . :
JMSF032K11+ GATGGTAGAGTGGTTCCGGGTGAAGTAATACTTATTGCCGGCTTTCAAATCCCAGTCTTC
JMFF022I07+ GATGGTAGAGTGGTTCCGGGTGAAGTAATACTTATTGCCGGCTTTCAAATCCCAGTCTTC
JMFF015F13+ GATGGTAGAGTGGTTCCGGGTGAAGTAATACTTATTGCCGGCTTTCAAATCCCAGTCTTC
JMSF049O01+ GATGGTAGAGTGGTTCCGGGTGAAGTAATACTTATTGCCGGCTTTCAAATCCCAGTCTTC
                      ____________________________________________________________
consensus GATGGTAGAGTGGTTCCGGGTGAAGTAATACTTATTGCCGGCTTTCAAATCCCAGTCTTC
 
. : . : . : . : . : . :
JMSF032K11+ TCTCTCTGAGACTTGCTGGTATCCTGCACTCTTCAGCTGCTTCTTCGCTTCCTCGACGGC
JMFF022I07+ TCTCTCTGAGACTTGCTGGTATCCTGCACTCTTCAGCTGCTTCTTCGCTTCCTCGACGGC
JMFF015F13+ TCTCTCTGAGACTTGCTGGTATCCTGCACTCTTCAGCTGCTTCTTCGCTTCCTCGACGGC
JMSF049O01+ TCTCTCTGAGACTTGCTGGTATCCTGCACTCTTCAGCTGCTTCTTCGCTTCCTCGACGGC
                      ____________________________________________________________
consensus TCTCTCTGAGACTTGCTGGTATCCTGCACTCTTCAGCTGCTTCTTCGCTTCCTCGACGGC
 
. : . : . : . : . : . :
JMSF032K11+ ATGGAAGGCTGTCGGCGACGCGTTCAAAAAGTCAACCAGATCAACTGCCGGTGAGTATTC
JMFF022I07+ ATGGAAGGCTGTCGGCGACGCGTTCAAAAAGTCAACCAGATCAACTGCCGGTGAGTATTC
JMFF015F13+ ATGGAAGGCTGTCGGCGACGCGTTCAAAAAGTCAACCAGATCAACTGCCGGTGAGTATTC
JMSF049O01+ ATGGAAGGCTGTCGGCGACGCGTTCAAAAAGTCAACCAGATCAACTGCCGGTGAGTATTC
                      ____________________________________________________________
consensus ATGGAAGGCTGTCGGCGACGCGTTCAAAAAGTCAACCAGATCAACTGCCGGTGAGTATTC
 
. : . : . : . : . : . :
JMSF032K11+ CATCGTTCGAAGCTACTATCTCTCTCTCGCAATAG
JMFF022I07+ CATCGTTCGAAGCTACTATCTCTCTCTCGCAATAG
JMFF015F13+ CATCGTTCGAAGCTACTATCTCTCTCTCGCAATAG
JMSF049O01+ CATCGTTCGAAGCTACTATCTCTCTCTCGCAATAGCAACCAAATTAGTAAGGGTTTTCTT
                      ____________________________________________________________
consensus CATCGTTCGAAGCTACTATCTCTCTCTCGCAATAGCAACCAAATTAGTAAGGGTTTTCTT
 
. : . : . : . : . : . :
JMSF049O01+ CAATTTTGTAGACTTCAGCAGTTCAGCATCCAGTTCATAATCCACTACGGCACTACCTTC
                      ____________________________________________________________
consensus CAATTTTGTAGACTTCAGCAGTTCAGCATCCAGTTCATAATCCACTACGGCACTACCTTC