Previous Contig 007943:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF034H13Sequence668007943 (2)474023619
JMSF049L16Sequence641007943 (2)678007967 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049L16+ ATATAAAACCTAAAACAGAAAACGCTCAGACAGTGCAAATAT
                      ____________________________________________________________
consensus ATATAAAACCTAAAACAGAAAACGCTCAGACAGTGCAAATAT
 
. : . : . : . : . : . :
JMSF034H13+ TTTCAGTTTTACCACACAAAACAAATTCACTCAGTAATCATGCGGAAAATTCTA
JMSF049L16+ TGACAGTTTCACTTTTACCACACAAAGAAAATTCACTCAGTTATCATGCGGAAAATTCTC
                      ____________________________________________________________
consensus TGACAGTTTCAGTTTTACCACACAAAGCAAATTCACTCAGTTATCATGCGGAAAATTCTC
 
. : . : . : . : . : . :
JMSF034H13+ AGTTCTACGATTATAGGTAGCAAAAGGAAGCAGCCAATTAATACTCCAGGTAACCTATGC
JMSF049L16+ AGCTCTACGATTATAGGTAGCAAAAGGAAGCAGGCAATTAATACAACAGGTAACCTACGC
                      ____________________________________________________________
consensus AGTTCTACGATTATAGGTAGCAAAAGGAAGCAGGCAATTAATACTCCAGGTAACCTATGC
 
. : . : . : . : . : . :
JMSF034H13+ ACATTAATATTT--GAGTTTCAGAATTACCTTTCGCAAATGTTGTTGTATGTACACTATT
JMSF049L16+ ACATTAAGATTTCAGAATTTAAGCATTACCTTTCGCAAATTTTGTTATATGTACACTGTT
                      ____________________________________________________________
consensus ACATTAATATTTCAGAGTTTCAGCATTACCTTTCGCAAATTTTGTTGTATGTACACTGTT
 
. : . : . : . : . : . :
JMSF034H13+ GAGACAACTTTTACACCAAAACGCCATTGTTA-TCATTAATCTTGCTGTTATTGCTCCAG
JMSF049L16+ GAGACAAGTTTGCAGCCAAAACGCCATTGTTAGACTGTAATCTTACTCTTATTGTTCACA
                      ____________________________________________________________
consensus GAGACAAGTTTTCCGCCAAAACGCCATTGTTAGTCTTTAATCTTGCTGTTATTGTTCCCG
 
. : . : . : . : . : . :
JMSF034H13+ AAATTCCTGTATATTAGGTTTTCACACAACCGGTAGAATCCACAGTTAGGGTTTTTCACT
JMSF049L16+ AAATACCTTGATATTAGGTTTCTCGACAACCGGTAGAATCCACAGATA-GTACACTGACT
                      ____________________________________________________________
consensus AAATTCCTTTATATTAGGTTTTTCGACAACCGGTAGAATCCACAGTTAGGTTTTTTGACT
 
. : . : . : . : . : . :
JMSF034H13+ CATCTCTAACCTCTTAGTCTAAAACAACATAAATGATTCTTAAACAGTAGATCGAACAAA
JMSF049L16+ CATCTCCAACCTCTTACTCTAAAACACCAGAATTGAATCTTGAACACTAGATCTAACAGA
                      ____________________________________________________________
consensus CATCTCTAACCTCTTAGTCTAAAACACCATAATTGATTCTTGAACAGTAGATCTAACAGA
 
. : . : . : . : . : . :
JMSF034H13+ AATTAGTGAGTTCGAACATTGTAAATGAGGTTGGTGTATAGACGAAACAA
JMSF049L16+ AATGAGTCAGTTCGAACATTGTATATGAGGTGGGTGTATAGACGAAACAAATTTCTTCGG
                      ____________________________________________________________
consensus AATTAGTGAGTTCGAACATTGTATATGAGGTTGGTGTATAGACGAAACAAATTTCTTCGG
 
. : . : . : . : . : . :
JMSF049L16+ TCATAATGAAATTGTGGTAGAAATAGAGTTGAAAACCTAAAGACTAAAGCGCCATGAACA
                      ____________________________________________________________
consensus TCATAATGAAATTGTGGTAGAAATAGAGTTGAAAACCTAAAGACTAAAGCGCCATGAACA
 
. : . : . : . : . : . :
JMSF049L16+ AGATCGGAGTGTTTAGGAGCGATCTTACATAGCGTTACAGACAAAGAGAGCTAAGGGAGT
                      ____________________________________________________________
consensus AGATCGGAGTGTTTAGGAGCGATCTTACATAGCGTTACAGACAAAGAGAGCTAAGGGAGT
 
. : . : . : . : . : . :
JMSF049L16+ ATCTATGCGATCGGAGTGAGTGTTAGAGAGAGAGAGGTAAGGGATTGTGGTTGTTCTACC
                      ____________________________________________________________
consensus ATCTATGCGATCGGAGTGAGTGTTAGAGAGAGAGAGGTAAGGGATTGTGGTTGTTCTACC