Previous Contig 007942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021E10Sequence695007942 (2)gb:AY057613_15640267e-17Arabidopsis thaliana AT3g58970/F17J16_20 mRNA, complete cds.>gb:AY150289_1584931728022977pir|G96635|G966353e-36hypothetical protein T7P1.15 [imported] - Arabidopsis thaliana>gb:AE005173_89377
JMSF049L12Sequence654007942 (2)gb:AY057613_15640262e-42Arabidopsis thaliana AT3g58970/F17J16_20 mRNA, complete cds.>gb:AY150289_1584931747013847 (2)gb:AY057613_15640267e-69Arabidopsis thaliana AT3g58970/F17J16_20 mRNA, complete cds.>gb:AY150289_1584931

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021E10+ CGGAAGAACCTCTTGAC
                      ____________________________________________________________
consensus CGGAAGAACCTCTTGAC
 
. : . : . : . : . : . :
JMSF021E10+ GCAGAGGTTCAAGCAACAAAAGTTCTTCAGAAGTTATTATAGCTCTTACAAACTCTAAGT
                      ____________________________________________________________
consensus GCAGAGGTTCAAGCAACAAAAGTTCTTCAGAAGTTATTATAGCTCTTACAAACTCTAAGT
 
. : . : . : . : . : . :
JMSF021E10+ AAATAACTAAACCCAATCAAAAACAACTCTTCTAACTCATCNTAAGCACAGTGATATTAT
                      ____________________________________________________________
consensus AAATAACTAAACCCAATCAAAAACAACTCTTCTAACTCATCNTAAGCACAGTGATATTAT
 
. : . : . : . : . : . :
JMSF021E10+ AAAGTAGTTGAGTATTTTTATATATAGACAATTATTACAGAAAAGAAACAGAAATGAGTG
                      ____________________________________________________________
consensus AAAGTAGTTGAGTATTTTTATATATAGACAATTATTACAGAAAAGAAACAGAAATGAGTG
 
. : . : . : . : . : . :
JMSF021E10+ CATTCATGAGTTCTGTATCTAACACACCAATAGCAATGACTCCAGATTGCATAATTAATT
                      ____________________________________________________________
consensus CATTCATGAGTTCTGTATCTAACACACCAATAGCAATGACTCCAGATTGCATAATTAATT
 
. : . : . : . : . : . :
JMSF021E10+ TGGTTATGAGATTCTTACATAGGTAAAGCATCAAACCCTACCTAACAACCTTTGCATATA
                      ____________________________________________________________
consensus TGGTTATGAGATTCTTACATAGGTAAAGCATCAAACCCTACCTAACAACCTTTGCATATA
 
. : . : . : . : . : . :
JMSF021E10+ GAATTGCAGGAATTCAATGGTGGAAAGCATGCATCACCAAATTCATAGCAAGCACTGGAT
                      ____________________________________________________________
consensus GAATTGCAGGAATTCAATGGTGGAAAGCATGCATCACCAAATTCATAGCAAGCACTGGAT
 
. : . : . : . : . : . :
JMSF021E10+ CAAAATATGCAAACACATTGTATTTACCGACATTCACATATAGGTAGGGAGAGAGAGAGA
                      ____________________________________________________________
consensus CAAAATATGCAAACACATTGTATTTACCGACATTCACATATAGGTAGGGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF021E10+ GAGTACGAAGGATACTGGAGGAGTGAGAGAATATAGGGCCGAGGATCCTCAAGTCCCTAG
JMSF049L12+ AAGGATACTGGAGGAGTGAGAGAATATAGGACCGAGGATCCTCAAGTCCCTAG
                      ____________________________________________________________
consensus GAGTACGAAGGATACTGGAGGAGTGAGAGAATATAGGGCCGAGGATCCTCAAGTCCCTAG
 
. : . : . : . : . : . :
JMSF021E10+ CAGGAATGGAGGCGCGTTTGATGATAGAGTTCTTATCGCACTCCATCAGCTCCGACTGCC
JMSF049L12+ CAGGAATGGAGGCGCGCTTGATGATAGAGCTCTTATCGCACTCCATCAGCTCCGATTGCC
                      ____________________________________________________________
consensus CAGGAATGGAGGCGCGTTTGATGATAGAGTTCTTATCGCACTCCATCAGCTCCGATTGCC
 
. : . : . : . : . : . :
JMSF021E10+ CCGTCCTGTCAAACCTCATTCACAGCCTGGCCCCAGCCGCCTTCTTCTTCCCGGGCTTGC
JMSF049L12+ CCGTCCTGTCAAACCTCATCCACAGCCTGGCCCCAACCGCCTTCTTCTTCCCGGGCTTGC
                      ____________________________________________________________
consensus CCGTCCTGTCAAACCTCATTCACAGCCTGGCCCCAGCCGCCTTCTTCTTCCCGGGCTTGC
 
. : . : . : . : . : . :
JMSF021E10+ TCGTTCCCGCACTCGACGCCAGCAAACTCCCGCCG
JMSF049L12+ TCGTCCCCGCACTGGACGCGACCAAAATCCCGCCGACGTTGCCGGAGGCTTGCTCCAATA
                      ____________________________________________________________
consensus TCGTTCCCGCACTGGACGCGAGCAAACTCCCGCCGACGTTGCCGGAGGCTTGCTCCAATA
 
. : . : . : . : . : . :
JMSF049L12+ CAGGAGTCGGCCTCGGCGACGTCACCGCCGCCGGCGCCGCTTTCTTCCTCCGCCGCAGCG
                      ____________________________________________________________
consensus CAGGAGTCGGCCTCGGCGACGTCACCGCCGCCGGCGCCGCTTTCTTCCTCCGCCGCAGCG
 
. : . : . : . : . : . :
JMSF049L12+ AGAATCGGCCCTTCCCCATCTCCCTCCCAACGGCCTCAACGTCTTTCTGCAAGCCGCATA
                      ____________________________________________________________
consensus AGAATCGGCCCTTCCCCATCTCCCTCCCAACGGCCTCAACGTCTTTCTGCAAGCCGCATA
 
. : . : . : . : . : . :
JMSF049L12+ CGTATCGTTAACCCACTTGAACTCGATCGACGAAGTCCTCTTCTTCCTCTTCTTCTTCCC
                      ____________________________________________________________
consensus CGTATCGTTAACCCACTTGAACTCGATCGACGAAGTCCTCTTCTTCCTCTTCTTCTTCCC