Previous Contig 007934:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006A13Sequence431007934 (3)gb:OSJN00033_16936301e-59Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete seque661008412 (2)gb:OSJN00033_16936302e-35Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete seque
JMFS127A03Sequence608007934 (3)pir|T01086|T010863e-46probable serine/threonine-specific protein kinase (EC 2.7.1.-) T10P11.10 - Arabi
JMSF049J20Sequence680007934 (3)pir|T01086|T010863e-40probable serine/threonine-specific protein kinase (EC 2.7.1.-) T10P11.10 - Arabi768008412 (2)gb:OSJN00033_16936308e-55Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0042L16, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006A13+ TCCCATGTAAGAGGGCTGCAGGGT
                      ____________________________________________________________
consensus TCCCATGTAAGAGGGCTGCAGGGT
 
. : . : . : . : . : . :
JMFF006A13+ CCTACATCTCCATGGAGCCACTGTTCCAAGTTTCCATTGTTGACATACTCATATACAAGC
                      ____________________________________________________________
consensus CCTACATCTCCATGGAGCCACTGTTCCAAGTTTCCATTGTTGACATACTCATATACAAGC
 
. : . : . : . : . : . :
JMFF006A13+ ATCCTATGTGCTCCCTCGGCGCAGTAACCAAGCAACCTCACCAGATTCTTGTGCCGGAAA
JMFS127A03+ A
                      ____________________________________________________________
consensus ATCCTATGTGCTCCCTCGGCGCAGTAACCAAGCAACCTCACCAGATTCTTGTGCCGGAAA
 
. : . : . : . : . : . :
JMFF006A13+ CGCCCAATTGCTTCAACTTCAACCTTAAACTCCCTCTCAGCTTGTCCCCTGTTATTGAGC
JMFS127A03+ CGCCCAATTGCTTCAACTTCAACCTTAAACTCCCTCTCAGCTTGTCCCCTGTTATTGAGC
                      ____________________________________________________________
consensus CGCCCAATTGCTTCAACTTCAACCTTAAACTCCCTCTCAGCTTGTCCCCTGTTATTGAGC
 
. : . : . : . : . : . :
JMFF006A13+ AGATTCTTTACAGCAACTTTAGTGTTGTCCTCGAGAACACCACAGTAAACAATGCCATAA
JMFS127A03+ AGATTCTTTACAGCAACTTTAGTGTTGTCCTCGAGAACACCACAGTAAACAATGCCATAA
JMSF049J20+ CACAGTAAACAATGCCATAA
                      ____________________________________________________________
consensus AGATTCTTTACAGCAACTTTAGTGTTGTCCTCGAGAACACCACAGTAAACAATGCCATAA
 
. : . : . : . : . : . :
JMFF006A13+ CCACCTTCACCAATCACATTCTCATCAGCAAACCCATTCGTCGCTATTTCGAGCTCCCTC
JMFS127A03+ CCACCTTCACCAATCACATTCTCATCAGCAAACCCATTCGTCGCTATTTCGAGCTCCCTC
JMSF049J20+ CCACCTTCACCAATCACATTCTCATCAGCAAACCCATTCGTCGCTATTTCGAGCTCCCTC
                      ____________________________________________________________
consensus CCACCTTCACCAATCACATTCTCATCAGCAAACCCATTCGTCGCTATTTCGAGCTCCCTC
 
. : . : . : . : . : . :
JMFF006A13+ AGAGTATACCAATGGCCCCACCCCAAGTGCGAAACCTCCGGCACAGTAATGGCGGGCGCC
JMFS127A03+ AGAGTATACCAATGGCCCCACCCCAAGTGCGAAACCTCCGGCACAGTAATGGCGGGCGCC
JMSF049J20+ AGAGTATACCAATGGCCCCACCCCAAGTGCGAAACCTCCGGCACAGTAATGGCGGGCGCC
                      ____________________________________________________________
consensus AGAGTATACCAATGGCCCCACCCCAAGTGCGAAACCTCCGGCACAGTAATGGCGGGCGCC
 
. : . : . : . : . : . :
JMFF006A13+ TGATCACCCGACCGCGACTCTCCACTCCCGCTGCCGGGACCAAC
JMFS127A03+ TGATCACCCGACCGCGACTCTCCACTCCCGCTGCCGGGACCAACACGCTGCTCCGGATAC
JMSF049J20+ TGATCACCCGACCGCGACTCTCCACTCCCGCTGCCGGGACCAACACGCTGCTCCGGATAC
                      ____________________________________________________________
consensus TGATCACCCGACCGCGACTCTCCACTCCCGCTGCCGGGACCAACACGCTGCTCCGGATAC
 
. : . : . : . : . : . :
JMFS127A03+ GAAATTCTGTGGCCCTTCCCTATTTCGATGTTAATTCTCTGCTGCCCACCGGAGCTGTGG
JMSF049J20+ GAAATTCTGTGGCCCTTCCCTATTTCGATGTTAATTCTCTGCTGCCCACCGGAGCTGTGG
                      ____________________________________________________________
consensus GAAATTCTGTGGCCCTTCCCTATTTCGATGTTAATTCTCTGCTGCCCACCGGAGCTGTGG
 
. : . : . : . : . : . :
JMFS127A03+ CTCTCGTCCTCGAAAAGGTCAGGCTCCGGGACCGGGTCGGGTACAGGAGCTGGCAAAAGC
JMSF049J20+ CTCTCGTCCTCGAAAAGGTCAGGCTCCGGGACCGGGTCGGGTACAGGAGCTGGCAAAAGC
                      ____________________________________________________________
consensus CTCTCGTCCTCGAAAAGGTCAGGCTCCGGGACCGGGTCGGGTACAGGAGCTGGCAAAAGC
 
. : . : . : . : . : . :
JMFS127A03+ ATGGGCTTTTCTGGATGTGTTCTGGAGGGGTCAATCCGGATTTCCTGAATCTCCTTGGAG
JMSF049J20+ ATGGGCTTTTCTGGATGTGTTCTGGAGGGGTCAATCCGGATTTCCTGAATCTCCTTGGAG
                      ____________________________________________________________
consensus ATGGGCTTTTCTGGATGTGTTCTGGAGGGGTCAATCCGGATTTCCTGAATCTCCTTGGAG
 
. : . : . : . : . : . :
JMFS127A03+ GCGTTGGGGATTTTGGAGTTCTTGTGAGCAAGAAGAGTGGTGGTAGACTTCTTACTGCTG
JMSF049J20+ GCGTTGGGGATTTTGGAGTTCTTGTGAGCAAGAAGAGTGGTGGTAGACTTCTTACTGCTG
                      ____________________________________________________________
consensus GCGTTGGGGATTTTGGAGTTCTTGTGAGCAAGAAGAGTGGTGGTAGACTTCTTACTGCTG
 
. : . : . : . : . : . :
JMFS127A03+ TTGCGGCGGGAGGTGAACCAGAGGGAGACGAGGAAGAGAACGAGCACAATTGCAGCTCCG
JMSF049J20+ TTGCGGCGGGAGGTGAACCAGAGGGAGACGAGGAAGAGAACGAGCACAATTGCAGCTCCG
                      ____________________________________________________________
consensus TTGCGGCGGGAGGTGAACCAGAGGGAGACGAGGAAGAGAACGAGCACAATTGCAGCTCCG
 
. : . : . : . : . : . :
JMFS127A03+ ACACA
JMSF049J20+ ACACAGATACCCAGAACGACCCATAACCGCAACCCGAATATCGAGGTGCGCTTCGATAGC
                      ____________________________________________________________
consensus ACACAGATACCCAGAACGACCCATAACCGCAACCCGAATATCGAGGTGCGCTTCGATAGC
 
. : . : . : . : . : . :
JMSF049J20+ TGATCGTTCAGAAACGCCGACATTCTCTTCTAGTCTTCTTCTTCAGCTTCAGCTGTGCTT
                      ____________________________________________________________
consensus TGATCGTTCAGAAACGCCGACATTCTCTTCTAGTCTTCTTCTTCAGCTTCAGCTGTGCTT
 
. : . : . : . : . : . :
JMSF049J20+ TAACGAAACTCGACACACCACATTTACAAAGAACCGTTGAAAGATTGAAGGACGAAGACC
                      ____________________________________________________________
consensus TAACGAAACTCGACACACCACATTTACAAAGAACCGTTGAAAGATTGAAGGACGAAGACC