Previous Contig 007931:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS062D01Sequence621007931 (3)gb:AY080685_15684145e-13Arabidopsis thaliana unknown protein (At5g13240) mRNA, complete cds.>gb:AY123009
JMSF003G12Sequence287007931 (3)gb:AY080685_15684145e-10Arabidopsis thaliana unknown protein (At5g13240) mRNA, complete cds.>gb:AY123009669013835 (2)gb:AY080685_15684142e-08Arabidopsis thaliana unknown protein (At5g13240) mRNA, complete cds.>gb:AY123009
JMSF049J04Sequence744007931 (3)gb:AY080685_15684147e-13Arabidopsis thaliana unknown protein (At5g13240) mRNA, complete cds.>gb:AY123009753013835 (2)gb:AY080685_15684142e-08Arabidopsis thaliana unknown protein (At5g13240) mRNA, complete cds.>gb:AY123009

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049J04+ TNGGAANGGTGCAGTACATAAAGC
                      ____________________________________________________________
consensus TNGGAANGGTGCAGTACATAAAGC
 
. : . : . : . : . : . :
JMFS062D01+ AATAATAATACTTTTTATGCATTATTAGGTTTCTAATTCAATGAAA
JMSF049J04+ TACAGGACAAAAGCAATAATAATACTTTTTATGCATTATTAGGTTTCTAATTCAATGAAA
                      ____________________________________________________________
consensus TACAGGACAAAAGCAATAATAATACTTTTTATGCATTATTAGGTTTCTAATTCAATGAAA
 
. : . : . : . : . : . :
JMFS062D01+ AAGTTTATTTTTTCTGAGATAATCTTCTGCTATCTCATCTGAAGGAAGCAAAAAAGGCCA
JMSF049J04+ AAGTTTATTTTTTCTGAGATAATCTTCTGCTATCTCATCTGAAGGAAGCAAAAAAGGCCA
                      ____________________________________________________________
consensus AAGTTTATTTTTTCTGAGATAATCTTCTGCTATCTCATCTGAAGGAAGCAAAAAAGGCCA
 
. : . : . : . : . : . :
JMFS062D01+ AAGAGAGAAATTTGACTATAAGTAAGACACATGGCACATGGATGACAGCTATTCTTTGAT
JMSF049J04+ AAGAGAGAAATTTGACTATAAGTAAGACACATGGCACATGGATGACAGCTATTCTTTGAT
                      ____________________________________________________________
consensus AAGAGAGAAATTTGACTATAAGTAAGACACATGGCACATGGATGACAGCTATTCTTTGAT
 
. : . : . : . : . : . :
JMFS062D01+ ATCTTGGACTGAGATCATAGAAAGCAAGAAAAGTATAAATGAGCACAGAAAACAAAATCA
JMSF049J04+ ATCTTGGACTGAGATCATAGAAAGCAAGAAAAGTATAAATGAGCACAGAAAACAAAATCA
                      ____________________________________________________________
consensus ATCTTGGACTGAGATCATAGAAAGCAAGAAAAGTATAAATGAGCACAGAAAACAAAATCA
 
. : . : . : . : . : . :
JMFS062D01+ CCTATGTACTTGTTCAAAAACATAAAATGGAGTATGATTTGTATCAGAGTACATGAGCTA
JMSF049J04+ CCTATGTACTTGTTCAAAAACATAAAATGGAGTATGATTTGTATCAGAGTACATGAGCTA
                      ____________________________________________________________
consensus CCTATGTACTTGTTCAAAAACATAAAATGGAGTATGATTTGTATCAGAGTACATGAGCTA
 
. : . : . : . : . : . :
JMFS062D01+ CAAACAATTTAAGTAATCAATTCAGTTAACCTCATTCTCCAAACTGAGAGACAGCTTCTT
JMSF049J04+ CAAACAATTTAAGTAATCAATTCAGTTAACCTCATTCTCCAAACTGAGAGACAGCTTCTT
                      ____________________________________________________________
consensus CAAACAATTTAAGTAATCAATTCAGTTAACCTCATTCTCCAAACTGAGAGACAGCTTCTT
 
. : . : . : . : . : . :
JMFS062D01+ ATCTGTTCCTGTATGTTTGCCTTGAAAACAAAGGGCAAAAGAACTTTTAACATCCTTAGA
JMSF049J04+ ATCTGTTCCTGTATGTTTGCCTTGAAAACAAAGGGCAAAAGAACTTTTAACATCCTTAGA
                      ____________________________________________________________
consensus ATCTGTTCCTGTATGTTTGCCTTGAAAACAAAGGGCAAAAGAACTTTTAACATCCTTAGA
 
. : . : . : . : . : . :
JMFS062D01+ TAGTCAAAATAGAACATAGTTCACTTGCCACCAACTATCATACTTACAAGAGTAAGGTTC
JMSF003G12+ CAAGAGTAAGGTTC
JMSF049J04+ TAGTCAAAATAGAACATAGTTCACTTGCCAATAACTATCATACTTACAAGAGTAAGGTTC
                      ____________________________________________________________
consensus TAGTCAAAATAGAACATAGTTCACTTGCCACTAACTATCATACTTACAAGAGTAAGGTTC
 
. : . : . : . : . : . :
JMFS062D01+ AAGACATCCCTTAACCGTGCGCTCTCCAAGGTTCACATGACTCAAAAATTCACTTATACG
JMSF003G12+ AAGACATCCCTTAACCGTGCGCTCTCCAAGGTTCACATGACTCAAAAATTCACTTATACG
JMSF049J04+ AAGACATCCCTTAACCGTGCGCTCTCCAAGGTTCACATGACTCAAAAATTCACTTATACG
                      ____________________________________________________________
consensus AAGACATCCCTTAACCGTGCGCTCTCCAAGGTTCACATGACTCAAAAATTCACTTATACG
 
. : . : . : . : . : . :
JMFS062D01+ ATCAAGTGGAGTGTATTCCAGGTACTTCATTGCAAATATATCAGAATGATAC----CTAT
JMSF003G12+ ATCAAGTGGAGTGTATTCCAGGTACTTCATTGCAAATATATCAGAATGATACCTAGCTAT
JMSF049J04+ ATCAAGTGGAGTGTATTCCAGGTACTTCATTGCAAATATATCAGAATGATACCTAGCTAT
                      ____________________________________________________________
consensus ATCAAGTGGAGTGTATTCCAGGTACTTCATTGCAAATATATCAGAATGATACCTAGCTAT
 
. : . : . : . : . : . :
JMFS062D01+ TTTCAACGTCGAGAGAGAGAACTTAGCGCTCGAATCAAA
JMSF003G12+ TTTCAACGTCGAGAGAGAGAACTTAGCGCTCGAATCAAACAGTCGCTGATTTATTTGCGT
JMSF049J04+ TTTCAACGTCGAGAGAGAGAACTTAGCGCTCGAATCAAACAGTCGCTGATTTATTTGCGT
                      ____________________________________________________________
consensus TTTCAACGTCGAGAGAGAGAACTTAGCGCTCGAATCAAACAGTCGCTGATTTATTTGCGT
 
. : . : . : . : . : . :
JMSF003G12+ TTTTAAGGGATATACGAATATAGGAAAGAGAACACAGACGGGGGAAGAACCCT
JMSF049J04+ TTTTAAGGGATATACGAATATAGGAAAGAGAACACAGACGGGGGAAGAACCCTAAATGCC
                      ____________________________________________________________
consensus TTTTAAGGGATATACGAATATAGGAAAGAGAACACAGACGGGGGAAGAACCCTAAATGCC