Previous Contig 007923:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN011G18Sequence610007923 (5)
JMSF044O06Sequence791007923 (5)gb:AC093919_17361266e-08Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1126_D01, complete s630007923 (5)gb:AP003242_18260883e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P041
JMSF049H23Sequence596007923 (5)683007923 (5)gb:AP003242_18260887e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P041

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044O06- AAAT
rJMSF049H23- AAT
                      ____________________________________________________________
consensus AAAT
 
. : . : . : . : . : . :
rJMSF044O06- CATCGACACTTCTTATTACAAGCGCACTAAACCACATCTAATCATATAAACAATACAATT
rJMSF049H23- CATCGACACCTCTTATTACAAGCGCACTAAACCACATCTAATCATATAAACAATACAATT
                      ____________________________________________________________
consensus CATCGACACTTCTTATTACAAGCGCACTAAACCACATCTAATCATATAAACAATACAATT
 
. : . : . : . : . : . :
rJMSF044O06- ATTACCCACCCACCCTTAATTTTCATCAGCAAAGAAGAAAATGAAGGCCGCAGCAATTTA
rJMSF049H23- ATTACCCACCCACCCTTAATTTTCATCAGCAAAGAAGAAAATGAAGGCCGCAGCAATTTA
                      ____________________________________________________________
consensus ATTACCCACCCACCCTTAATTTTCATCAGCAAAGAAGAAAATGAAGGCCGCAGCAATTTA
 
. : . : . : . : . : . :
rJMSF044O06- ATCTGTTATTATCCACCTCACATGCAGTCCCCACGAACTTCACTACCCACAGATTCCATT
rJMSF049H23- ATCTGTTATTATCCACCTCACATGCAGTCCCCACGAACTTCACTACCCACAGATTCCATT
                      ____________________________________________________________
consensus ATCTGTTATTATCCACCTCACATGCAGTCCCCACGAACTTCACTACCCACAGATTCCATT
 
. : . : . : . : . : . :
rJMSF044O06- ATTCGGATGTCACATCCTAGCTAGCCCTTTATTTATTTCTTCATACCAAATAATACTAAT
rJMSF049H23- ATTCGGATGTCACATCCTAGCTAGCCCTTTATTTATTTCTTCATACCAAATAATACTAAT
                      ____________________________________________________________
consensus ATTCGGATGTCACATCCTAGCTAGCCCTTTATTTATTTCTTCATACCAAATAATACTAAT
 
. : . : . : . : . : . :
rJMSF044O06- AATAGTAACCTAACTTATGTACATCATCCCAACCCCGCCGGAATTTCGACGACTTTAATA
rJMSF049H23- AATAGTAACCTAACTTATGTACATCATCCCAACCCCGCCGGAATTTCGACGACTTTAATA
                      ____________________________________________________________
consensus AATAGTAACCTAACTTATGTACATCATCCCAACCCCGCCGGAATTTCGACGACTTTAATA
 
. : . : . : . : . : . :
rJMSF044O06- AGTCCACTCTTGTGGTAGTTGCATCTCCTGGTCGATCGTTGCCGGTTGCGTTTCGACGTC
rJMSF049H23- AGTCCACTCTTGTGGTAGTTGCATCTCCTGGTCGATCGTTGCCGGTTGCGTTTCGACGTC
                      ____________________________________________________________
consensus AGTCCACTCTTGTGGTAGTTGCATCTCCTGGTCGATCGTTGCCGGTTGCGTTTCGACGTC
 
. : . : . : . : . : . :
rJMSF044O06- CGAATGTTGTTCTATTTGTGGAAGCGAGTCTTCTATTTTATTCCCCGTAGCAAACTGTAC
rJMSF049H23- CGAATGTTGTTCTATTTGTGGAAGCGAGTCTTCTATTTTATTCCCCGTAGCAAACTGTAC
                      ____________________________________________________________
consensus CGAATGTTGTTCTATTTGTGGAAGCGAGTCTTCTATTTTATTCCCCGTAGCAAACTGTAC
 
. : . : . : . : . : . :
rJMSF044O06- TGGGCGATTACTAGGAGAGGCAGCATAGGTGTTTGATTGTGACTTGGC-TTCCATAGTGC
rJMSF049H23- TGGGCGATTACTAGGAGAGGCAGCATAGGTGTTTGATTGTGACTTGGC-TTCCATAGTGC
JMSF044O06+ AGGAGAGGCAGCATAGGTGTTTGATTGTGACTTGGCTTTCCATAGTGC
                      ____________________________________________________________
consensus TGGGCGATTACTAGGAGAGGCAGCATAGGTGTTTGATTGTGACTTGGC-TTCCATAGTGC
 
. : . : . : . : . : . :
rJMSF044O06- TGAAGTGGTGCTGTAGAGCTTGCAATACTCTTGTAGGTATTAAGACCGTAGAGCACCCAG
rJMSF049H23- TGAAGTGGTGCTGTAGAGCTTGCAATACTCTTGTAGGTATTAAGACCGTAGAGCACCCAG
JMSF044O06+ TGAAGTGGTGCTGTAGAGCTTGCAATACTCTTGTAGGTATTAAGACCGTAGAGCACCCAG
                      ____________________________________________________________
consensus TGAAGTGGTGCTGTAGAGCTTGCAATACTCTTGTAGGTATTAAGACCGTAGAGCACCCAG
 
. : . : . : . : . : . :
rJMSF044O06- TTTTCTTCTTGGGTTCGGGTTGGCTGTGGTAGTTGCAACCACGGGGAATGAAAACGCCTG
rJMSF049H23- TTTTCTTCTTGGGTTCGGGTTGGCTGTGGTAGTTGCAACCACGGGGAATGAAAACGCCTG
JMSF044O06+ TTTTCTTCTTGGGTTCGGGTTGGCTGTGGTAGTTGCAACCACGGGGAATGAAAACGCCTG
                      ____________________________________________________________
consensus TTTTCTTCTTGGGTTCGGGTTGGCTGTGGTAGTTGCAACCACGGGGAATGAAAACGCCTG
 
. : . : . : . : . : . :
rJMSF044O06- TCCCACTACTGGAAGCACCGGTTACGT
rJMSF049H23- TCCCACTACTGGAAGCACCGGTTACGTAGCCGGAGCCTCCGAGGAAAACCGCCTGCATAC
JMSF044O06+ TCCCACTACTGGAAGCACCGGTTACGTAGCCGGAGCCTCCGAGGAAAACCGCCTGCATAC
                      ____________________________________________________________
consensus TCCCACTACTGGAAGCACCGGTTACGTAGCCGGAGCCTCCGAGGAAAACCGCCTGCATAC
 
. : . : . : . : . : . :
rJMSF049H23- CCGACCCGCTTCTCAACGTGT
JMSF044O06+ CCGACCCGCTTCTCAACGTGTGGGCCCTTCCACCGCCATGTCCGTTTCCTCTTCTTCTGC
JMFN011G18+ CCGTTTCCTCTTCTTCTGC
                      ____________________________________________________________
consensus CCGACCCGCTTCTCAACGTGTGGGCCCTTCCACCGCCATGTCCGTTTCCTCTTCTTCTGC
 
. : . : . : . : . : . :
JMSF044O06+ CTTTCTTCGGCATGTGGTGCTCCGCCTCCGCTGCGTGCTCAACTCGTGGATGAATCGACT
JMFN011G18+ CTTTCTTCGGCATGTGGTGCTCCGCCTCCGCTGCGTGCTCAACTCGTGGATGAATCGACT
JMSF049H23+ CTTCGGCATGTGGTGCTCCGCCTCCGCTGCGTGCTCAACTCGTGGATGAATCGACT
                      ____________________________________________________________
consensus CTTTCTTCGGCATGTGGTGCTCCGCCTCCGCTGCGTGCTCAACTCGTGGATGAATCGACT
 
. : . : . : . : . : . :
JMSF044O06+ CGGTTTTCGCGACTCGTCTTCCTCGCGGAGTAGGATTACTCTGTTTTCTCAAGGATGATT
JMFN011G18+ CGGTTTTCGCGACTCGTCTTCCTCGCGGAGTAGGATTACTCTGTTTTCTCAAGGATGATT
JMSF049H23+ CGGTTTTCGCGACTCGTCTTCCTCGCGGAGTAGGATTACTCTGTTTTCTCAAGGATGATT
                      ____________________________________________________________
consensus CGGTTTTCGCGACTCGTCTTCCTCGCGGAGTAGGATTACTCTGTTTTCTCAAGGATGATT
 
. : . : . : . : . : . :
JMSF044O06+ GGTCTCTCATCGTGTAAACTTCGATTGGTCTCATCGCGTAATTTGCAGAGTCTGAATTCG
JMFN011G18+ GGTCTCTCATCGTGTAAACTTCGATTGGTCTAATCGCGTAATTTGCAGAGTCTGAATTCG
JMSF049H23+ GGTCTCTCATCGTGTAAACTTCGATTGGTCTCATCGCGTAATTTGCAGAGTCTGAATTCG
                      ____________________________________________________________
consensus GGTCTCTCATCGTGTAAACTTCGATTGGTCTCATCGCGTAATTTGCAGAGTCTGAATTCG
 
. : . : . : . : . : . :
JMSF044O06+ CAGATGAGTTCGCAAGTTCCTCCTTGAATTTGGGAGAGTGTTCATGATCTTCAACCAAAA
JMFN011G18+ CAGATGAGTTCGCAAGTTCCTCCTTGAATTTGGGAGAGTGTTCATGATCTTCAACCAAAA
JMSF049H23+ CAGATGAGTTCGCAAGTTCCTCCTTGAATTTGGGAGAGTGTTCATGATCTTCAACCAAAA
                      ____________________________________________________________
consensus CAGATGAGTTCGCAAGTTCCTCCTTGAATTTGGGAGAGTGTTCATGATCTTCAACCAAAA
 
. : . : . : . : . : . :
JMSF044O06+ TATTCGGCTCATCATCTTCATCCTGAAGCATATAACCGGCCATCTGGCGAGTCAACTCAG
JMFN011G18+ TATTCGGCTCATCATCTTCATCCTGAAGCATATAACCGGCCATCTGGCGAGTCAACTCAG
JMSF049H23+ TATTCGGCTCATCATCTTCATCCTGAAGCATATAACCGGCCATCTGGCGAGTCAACTCAG
                      ____________________________________________________________
consensus TATTCGGCTCATCATCTTCATCCTGAAGCATATAACCGGCCATCTGGCGAGTCAACTCAG
 
. : . : . : . : . : . :
JMSF044O06+ CGAGGAAATCCTCGCCTTCGTCGTCGTCGCTCTCTGTTTCAGTTCTGGTGGAGCCGACGG
JMFN011G18+ CGAGGAAATCCTCGCCTTCGTCGTCGTCGCTCTCTGTTTCAGTTCTGGTGGAGCCGACGG
JMSF049H23+ CGAGGAAATCCTCGCCTTCGTCGTCGTCGCTCTCTGTTTCAGTTCTGGTGGAGCCGACGG
                      ____________________________________________________________
consensus CGAGGAAATCCTCGCCTTCGTCGTCGTCGCTCTCTGTTTCAGTTCTGGTGGAGCCGACGG
 
. : . : . : . : . : . :
JMSF044O06+ AACCGAAGGGCGTGCTGAGGCCGGAAGACGAGTTCTCGGAGCCGAACAGGGAATCGGCGA
JMFN011G18+ AACCGAAGGGCGTGCTGAGGCCGGAAGACGAGTTCTCGGAGCCGAACAGGGAATCGGCGA
JMSF049H23+ AACCGAAGGGCGTGCTGAGGCCGGAAGACGAGTTCTCGGAGCCGAACAGGGAATCGGCGA
                      ____________________________________________________________
consensus AACCGAAGGGCGTGCTGAGGCCGGAAGACGAGTTCTCGGAGCCGAACAGGGAATCGGCGA
 
. : . : . : . : . : . :
JMSF044O06+ CCCAAATAGGAGGAGGAAGGAGAGGAGGCTCTTTACCATGCAGGTCTGAAGAAGAATCCA
JMFN011G18+ CCCAAATAGGAGGAGGAAGGAGAGGAGGCTCTTTACCATGCAGGTCTGAAGAAGAATCCA
JMSF049H23+ CCCAAATAGGAGGAGGAAGGAGAGGAGGCTCTTTACCATGCAGGTCTGAAGAAGAATCCA
                      ____________________________________________________________
consensus CCCAAATAGGAGGAGGAAGGAGAGGAGGCTCTTTACCATGCAGGTCTGAAGAAGAATCCA
 
. : . : . : . : . : . :
JMSF044O06+ TGGAGGCCCAAAGGAATGAT
JMFN011G18+ TGGAGGCCCAAAGGAATGATTCGAGGAGAGTGGAGATTCCTAGCGGTTTTTGATAGGGAA
JMSF049H23+ TGGAGGCCCAAAGGAATGATTCGAGGAGAGTGGAGATTCCTAGCGGTTTTTGATAGGGAA
                      ____________________________________________________________
consensus TGGAGGCCCAAAGGAATGATTCGAGGAGAGTGGAGATTCCTAGCGGTTTTTGATAGGGAA
 
. : . : . : . : . : . :
JMFN011G18+ GAGAGGAGGCGAGATGAGATGAGAGGAGATGAGAGGAGATGA
JMSF049H23+ GAGAGGAGGCGAGATGAGATGAGAGGAGATGAGAGGAGATGAGATAACAATGAAAAAACC
                      ____________________________________________________________
consensus GAGAGGAGGCGAGATGAGATGAGAGGAGATGAGAGGAGATGAGATAACAATGAAAAAACC