Previous Contig 007911:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF009A23Sequence330007911 (6)gb:AY057485_15639047e-13Arabidopsis thaliana AT3g08680/F17O14_15 mRNA, complete cds.>gb:BT000497_1634775745013937 (6)gb:AB019228_15141045e-58Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF010D23Sequence393007911 (6)gb:AY057485_15639042e-22Arabidopsis thaliana AT3g08680/F17O14_15 mRNA, complete cds.>gb:BT000497_1634775753013937 (6)gb:AB019228_15141042e-65Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF028P12Sequence666007911 (6)gb:AB019228_15141042e-46Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661735013937 (6)gb:AB019228_15141041e-61Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF035I22Sequence689007911 (6)gb:AB019228_15141047e-49Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661586013937 (6)gb:AB019228_15141042e-43Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF049F01Sequence572007911 (6)gb:AY057485_15639049e-22Arabidopsis thaliana AT3g08680/F17O14_15 mRNA, complete cds.>gb:BT000497_1634775751013937 (6)gb:AB019228_15141045e-63Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661
JMSF051F13Sequence653007911 (6)gb:AB019228_15141042e-52Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661767013937 (6)gb:AB019228_15141041e-64Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCK7.>gb:AY065009_15661

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051F13+ GAATCTGGGATCGAGCCATTTAGCATGTTGTGACTCAAATTTAA
JMSF035I22+ TGACTCAAATTTAA
                      ____________________________________________________________
consensus GAATCTGGGATCGAGCCATTTAGCATGTTGTGACTCAAATTTAA
 
. : . : . : . : . : . :
JMSF051F13+ GTTCTTTAGCCTCGAAGACTCGAGATCAGGAACCGCACCAGATANCAAGTTATATTGCAG
JMSF035I22+ GTTCTTTAGCCTCGAAGACTCGAGATCAGGAACCGCACCAGATAACAAGTTATATTGCAG
JMSF028P12+ CCTCGAAGACTCGAGATCAGGAACCGCACCAGATAACAAGTTATATTGCAG
                      ____________________________________________________________
consensus GTTCTTTAGCCTCGAAGACTCGAGATCAGGAACCGCACCAGATAACAAGTTATATTGCAG
 
. : . : . : . : . : . :
JMSF051F13+ GTTCAGAACAGATAATCGCGACAAATTCTTGATTGCAAGTGGAATTTCGCCAGTAAAAGA
JMSF035I22+ GTTCAGAACAGATAATCGCGACAAATTCTTGATTGCAAGTGGAATTTCGCCAGTAAAAGA
JMSF028P12+ GTTCAGAACAGATAATCGCGACAAATTCTTGATTGCAAGTGGAATTTCGCCAGTAAAAGA
                      ____________________________________________________________
consensus GTTCAGAACAGATAATCGCGACAAATTCTTGATTGCAAGTGGAATTTCGCCAGTAAAAGA
 
. : . : . : . : . : . :
JMSF051F13+ GTTAAAGGAAAGATTTAACACACCTAGCTGGGGAGAAAGCGAGGTGGGGATATTCCCAGT
JMSF035I22+ GTTAAAGGAAAGATTTAACACACCTAGCTGGGGAGAAAGCGAGGTGGGGATATTCCCAGT
JMSF028P12+ GTTAAAGGAAAGATTTAACACACCTAGCTGGGGAGAAAGCGAGGTGGGGATATTCCCAGT
                      ____________________________________________________________
consensus GTTAAAGGAAAGATTTAACACACCTAGCTGGGGAGAAAGCGAGGTGGGGATATTCCCAGT
 
. : . : . : . : . : . :
JMSF051F13+ GAAGTTATTGTGCTGAAGGTAGACCGATTGGAGAGACGGGATGGAGAGGATATCAGAA-G
JMSF035I22+ GAAGTTATTGTGCTGAAGGTAGACCGATTGGAGAGACGGGATGGAGAGGATATCAGAA-G
JMSF028P12+ GAAGTTATTGTGCTGAAGGTAGACCGATTGGAGAGACGGGATGGAGAGGATATCAGAA-G
JMSF049F01+ ATTGGAGAGACGGGATGGAGAGGATATCAGAAGG
                      ____________________________________________________________
consensus GAAGTTATTGTGCTGAAGGTAGACCGATTGGAGAGACGGGATGGAGAGGATATCAGAA-G
 
. : . : . : . : . : . :
JMSF051F13+ GAAGATTCCCATTCAAACGGTTGCCCCGAAGGCTTAGAACCCGAAGACCATCCAGCTTTC
JMSF035I22+ GAAGATTCCCATTCAAACGGTTGCCCCGAAGGCTTAGAACCCGAAGACCATCCAGCTTTC
JMSF028P12+ GAAGATTCCCATTCAAACGGTTGCCCCGAAGGCTTAGAACCCGAAGACCATCCAGCTTTC
JMSF010D23+ AAGACCATCCAGCTTTC
JMSF049F01+ GAAGATTCCCATTCAAACGGTTGCCCCGAAGGCTTAGAACCCGAAGACCATCCAGCTTTC
                      ____________________________________________________________
consensus GAAGATTCCCATTCAAACGGTTGCCCCGAAGGCTTAGAACCCGAAGACCATCCAGCTTTC
 
. : . : . : . : . : . :
JMSF051F13+ CAATAGTGTTGGGCGGGATAGAACCATAAAGACCAACACCAGGGAGATGGAGAGCTACAA
JMSF035I22+ CAATAGTGTTGGGCGGGATAGAACCATAAAGACCAACACCAGGAAGATGGAGAGCTACAA
JMSF028P12+ CAATAGTGTTGGGCGGGATAGAACCATAAAGACCAACACCAGGGAGATGGAGAGCTACAA
JMSF010D23+ CAATAGTGTTGGGCGGGATAGAACCATAAAGACCAACACCAGGAAGATGGAGAGCTACAA
JMSF009A23+ GGAGAGCTACAA
JMSF049F01+ CAATAGTGTTGGGCGGGATAGAACCATAAAGACCAACACCAGGGAGATGGAGAGCTACAA
                      ____________________________________________________________
consensus CAATAGTGTTGGGCGGGATAGAACCATAAAGACCAACACCAGGGAGATGGAGAGCTACAA
 
. : . : . : . : . : . :
JMSF051F13+ C-TCTGG-TCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
JMSF035I22+ C-TCTGG-TCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
JMSF028P12+ C-TCTGG-TCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
JMSF010D23+ C-TCTGG-TCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
JMSF009A23+ CTTCTGGNTCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
JMSF049F01+ C-TCTGG-TCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
                      ____________________________________________________________
consensus C-TCTGG-TCCCGTCTTTACTGCATTTGATGCCAGTCCAAGACCCGCAGATTGGGAGAGT
 
. : . : . : . : . : . :
JMSF051F13+ AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
JMSF035I22+ AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
JMSF028P12+ AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
JMSF010D23+ AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
JMSF009A23+ AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
JMSF049F01+ AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
                      ____________________________________________________________
consensus AGAATTCCAGTTGAGCTTTCGTCGATGAGGAACAGATGCAGAAAACTCGAGCAAGGCCTT
 
. : . : . : . : . : . :
JMSF051F13+ TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
JMSF035I22+ TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
JMSF028P12+ TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
JMSF010D23+ TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
JMSF009A23+ TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
JMSF049F01+ TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
                      ____________________________________________________________
consensus TCCATCGGAGTCAAGATCAGCAACAATCCCCGGAAGAAAGAAAACAGAAGCAACAGCTGC
 
. : . : . : . : . : . :
JMSF051F13+ TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
JMSF035I22+ TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
JMSF028P12+ TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
JMSF010D23+ TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
JMSF009A23+ TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
JMSF049F01+ TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
                      ____________________________________________________________
consensus TAGTAAGAGATGAATTCTCATCGCGATTTTCTTAATGGCTGCTAGTAAGCGAGGCTGCCA
 
. : . : . : . : . : . :
JMSF051F13+ TATAATAATG
JMSF035I22+ TATAATAATGCTCGAGAAATGGAGTCTGAGCAGCTATATATGGCGAGAATGCGAGACCTT
JMSF028P12+ TATAATAATGCTCGAGAAATGGAGTCTGAGCAGCTATATATGGCGAGAATGCGAGACCTT
JMSF010D23+ TATAATAATGCTCGAGAAATGGAGTCTGAGCAGCTATATATGGCGAGAATGCGAGACCTT
JMSF009A23+ TATAATAATGCTCGAGAAATGGAGTCTGAGCAGCTATATATGGCGAGAATGCGAGACCTT
JMSF049F01+ TATAATAATGCTCGAGAAATGGAGTCTGAGCAGCTATATATGGCGAGAATGCGAGACCTT
                      ____________________________________________________________
consensus TATAATAATGCTCGAGAAATGGAGTCTGAGCAGCTATATATGGCGAGAATGCGAGACCTT
 
. : . : . : . : . : . :
JMSF035I22+ ATACATCATGCATCAA
JMSF028P12+ ATACATCATGCATCAA
JMSF010D23+ ATACATCATGCATCAA
JMSF009A23+ ATACATCATGCATCAA
JMSF049F01+ ATACATCATGCATCAATGATTGGACCGCCTTTTCTCTGCATATTTAAATTTTGCAGGCAC
                      ____________________________________________________________
consensus ATACATCATGCATCAATGATTGGACCGCCTTTTCTCTGCATATTTAAATTTTGCAGGCAC
 
. : . : . : . : . : . :
JMSF049F01+ AGTGAATCTTAGCAAAGAAGGCATGCTACACACAAAGGAGCTCATCAAAGCTAAAGAGTC
                      ____________________________________________________________
consensus AGTGAATCTTAGCAAAGAAGGCATGCTACACACAAAGGAGCTCATCAAAGCTAAAGAGTC