Previous Contig 007909:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049E13Sequence712007909 (2)722013919 (2)gb:AB033019_18661996e-15Homo sapiens mRNA for KIAA1193 protein, partial cds.
JMSF051C04Sequence688007909 (2)751013919 (2)gb:AB033019_18661992e-12Homo sapiens mRNA for KIAA1193 protein, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051C04+ TAACCAATTGAATGTTTTAAAAGGACCATATTGAGAAAATG
JMSF049E13+ TTTGAAACTAGTAACCAATTGAATGTTTTAAAAGGACCATATTGAGAAAATG
                      ____________________________________________________________
consensus TTTGAAACTAGTAACCAATTGAATGTTTTAAAAGGACCATATTGAGAAAATG
 
. : . : . : . : . : . :
JMSF051C04+ GTTTTCTTGTTCCAGCAGTTTTGACAGCTCTCTATGGTTTTGCAGAACAAAAAAAGGCAG
JMSF049E13+ GTTTTCTTGTTCCAGCAGTTTTGACAGCTCTCTATGGTTTTGCAGAACAAAAAAAGGCAG
                      ____________________________________________________________
consensus GTTTTCTTGTTCCAGCAGTTTTGACAGCTCTCTATGGTTTTGCAGAACAAAAAAAGGCAG
 
. : . : . : . : . : . :
JMSF051C04+ TTTTCAAACCTCAGATGTTTGTGAGAAATAGGCAAGAATAGAAACTAACAACAAAGTTAC
JMSF049E13+ TTTTCAAACCTCAGATGTTTGTGAGAAATAGGCAAGAATAGAAACTAACAACAAAGTTAC
                      ____________________________________________________________
consensus TTTTCAAACCTCAGATGTTTGTGAGAAATAGGCAAGAATAGAAACTAACAACAAAGTTAC
 
. : . : . : . : . : . :
JMSF051C04+ AGTACATGTAAATGCCAACACCACAATATTCAAAAGAGTGTATAAATTTTGCAAGATTAA
JMSF049E13+ AGTACATGTAAATGCCAACACCACAATATTCAAAAGAGTGTATAAATTTTGCAAGATTAA
                      ____________________________________________________________
consensus AGTACATGTAAATGCCAACACCACAATATTCAAAAGAGTGTATAAATTTTGCAAGATTAA
 
. : . : . : . : . : . :
JMSF051C04+ GCAAGAAACCAACATAACACAATAAAAAAACTATGTAAATGCCATTATAAGTACTAGAAT
JMSF049E13+ GCAAGAAACCAACATAACACAATAAAAAAACTATGTAAATGCCATTATAAGTACTAGAAT
                      ____________________________________________________________
consensus GCAAGAAACCAACATAACACAATAAAAAAACTATGTAAATGCCATTATAAGTACTAGAAT
 
. : . : . : . : . : . :
JMSF051C04+ CAAACTTTTGATCAATTCAAAGATGAAAAAAAATTGAAAACTTTCTGGAAAACTACATTC
JMSF049E13+ CAAACTTTTGATCAATTCAAAGATGAAAAAAAATTGAAAACTTTCTGGAAAACTACATTC
                      ____________________________________________________________
consensus CAAACTTTTGATCAATTCAAAGATGAAAAAAAATTGAAAACTTTCTGGAAAACTACATTC
 
. : . : . : . : . : . :
JMSF051C04+ AGCTTCACTCTGATCCTTGGGCTACCAAAACACTCTCTCTGTCAGAACAAGAAATGGGTA
JMSF049E13+ AGCTTCACTCTGATCCTTGGGCTACCAAAACACTCTCTCTGTCAGAACAAGAAATGGGTA
                      ____________________________________________________________
consensus AGCTTCACTCTGATCCTTGGGCTACCAAAACACTCTCTCTGTCAGAACAAGAAATGGGTA
 
. : . : . : . : . : . :
JMSF051C04+ CTCAAAAAATAGAATGTAGGATCAGAAATAAGGCAGAATTTCTTGTTACATTAACTAACT
JMSF049E13+ CTCAAAAAATAGAATGTAGGATCAGAAATAAGGCAGAATTTCTTGTTACATTAACTAACT
                      ____________________________________________________________
consensus CTCAAAAAATAGAATGTAGGATCAGAAATAAGGCAGAATTTCTTGTTACATTAACTAACT
 
. : . : . : . : . : . :
JMSF051C04+ CCTTCTTCTGTACAAGATTAAAAAAAGGAAGCTTTTTTCATAGCTGAAAATCATGAAATT
JMSF049E13+ CCTTCTTCTGTACAAGATTAAAAAAAGGAAGCTTTTTTCATAGCTGAAAATCATGAAATT
                      ____________________________________________________________
consensus CCTTCTTCTGTACAAGATTAAAAAAAGGAAGCTTTTTTCATAGCTGAAAATCATGAAATT
 
. : . : . : . : . : . :
JMSF051C04+ CATCAAGCTGGTTTCAGACAAGCAATTTTAGGAGTATATATATACATACGTACGTACACA
JMSF049E13+ CATCAAGCTGGTTTCAGACAAGCAATTTTAGGAGTATATATATACATACGTACGTACACA
                      ____________________________________________________________
consensus CATCAAGCTGGTTTCAGACAAGCAATTTTAGGAGTATATATATACATACGTACGTACACA
 
. : . : . : . : . : . :
JMSF051C04+ GAAGCACAAAACGTACGATATGGAAGGCAATTAGGTGAAGATAAGGGCCGAATAATTCTC
JMSF049E13+ GAAGCACAAAACGTACGATATGGAAGGCAATTAGGTGAAGATAAGGGCCGAATAATTCTC
                      ____________________________________________________________
consensus GAAGCACAAAACGTACGATATGGAAGGCAATTAGGTGAAGATAAGGGCCGAATAATTCTC
 
. : . : . : . : . : . :
JMSF051C04+ CGGTGGCCGGAGACGTCGGGAAACTGATGAGAGACCTCGCGCCGGC
JMSF049E13+ CGGTGGCCGGAGACGTCGGGAAACTGATGAGAGACCTCGCGCCGGCGCAGCACGGCAGCC
                      ____________________________________________________________
consensus CGGTGGCCGGAGACGTCGGGAAACTGATGAGAGACCTCGCGCCGGCGCAGCACGGCAGCC