Previous Contig 007908:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049E07Sequence511007908 (2)466007908 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049E07+ GGAACAGAACAGAACAGAACGAAGCTATCGA
JMSF049E07- GGAACAGAACAGAACAGAACGAAGCTATCGA
                      ____________________________________________________________
consensus GGAACAGAACAGAACAGAACGAAGCTATCGA
 
. : . : . : . : . : . :
rJMSF049E07+ TCGCCTTAAGGACGCCAGGTTGATGGAATTCTCAGATGTATCCTCTGAGTTGTTGTTCAG
JMSF049E07- TCGCCTTAAGGACGCCAGGTTGATGGAATTCTCAGATGTATCCTCTGAGTTGTTGTTCAG
                      ____________________________________________________________
consensus TCGCCTTAAGGACGCCAGGTTGATGGAATTCTCAGATGTATCCTCTGAGTTGTTGTTCAG
 
. : . : . : . : . : . :
rJMSF049E07+ TAATCTGGGCGAGAACTTGGTAGTTGAAATCCTGGCCAGGCTCCCCTGCAGAACAGCAAT
JMSF049E07- TAATCTGGGCGAGAACTTGGTAGTTGAAATCCTGGCCAGGCTCCCCTGCAGAACAGCAAT
                      ____________________________________________________________
consensus TAATCTGGGCGAGAACTTGGTAGTTGAAATCCTGGCCAGGCTCCCCTGCAGAACAGCAAT
 
. : . : . : . : . : . :
rJMSF049E07+ CCGGTTGAAATTGCAGCGTGATGCTTCACCACCGACTTGCTTCGCGCCGAGTCCGCCTCA
JMSF049E07- CCGGTTGAAATTGCAGCGTGATGCTTCACCACCGACTTGCTTCGCGCCGAGTCCGCCTCA
                      ____________________________________________________________
consensus CCGGTTGAAATTGCAGCGTGATGCTTCACCACCGACTTGCTTCGCGCCGAGTCCGCCTCA
 
. : . : . : . : . : . :
rJMSF049E07+ AATTCCACAGTTCCTCTCCGTTGCCGACCCTCTCTGTGTGCGTTTCTCCATGGTTGGCTC
JMSF049E07- AATTCCACAGTTCCTCTCCGTTGCCGACCCTCTCTGTGTGCGTTTCTCCATGGTTGGCTC
                      ____________________________________________________________
consensus AATTCCACAGTTCCTCTCCGTTGCCGACCCTCTCTGTGTGCGTTTCTCCATGGTTGGCTC
 
. : . : . : . : . : . :
rJMSF049E07+ TTCCATCAGGCAGTCAAAGTATCGAAAGAGGAATGCACTTTTTTTCCTTTCTGTTGGACA
JMSF049E07- TTCCATCAGGCAGTCAAAGTATCGAAAGAGGAATGCACTTTTTTTCCTTTCTGTTGGACA
                      ____________________________________________________________
consensus TTCCATCAGGCAGTCAAAGTATCGAAAGAGGAATGCACTTTTTTTCCTTTCTGTTGGACA
 
. : . : . : . : . : . :
rJMSF049E07+ AGTTACCTTCTGATGTTTAAGTGGTCTCATCCTTGTATGGTTAGTAAATTGGTCATATTT
JMSF049E07- AGTTACCTTCTGATGTTTAAGTGGTCTCATCCTTGTATGGTTAGTAAATTGGTCATATTT
                      ____________________________________________________________
consensus AGTTACCTTCTGATGTTTAAGTGGTCTCATCCTTGTATGGTTAGTAAATTGGTCATATTT
 
. : . : . : . : . : . :
rJMSF049E07+ GGTGCTGGAAGGTTTATTATAATTGCACTGTCACTTCCATCATATGCAGTTTAAGATATG
JMSF049E07- GGTGCTGGAAGGTTTATTATAATTGCACTGTCACTTCCATCATATGCAGTTTAAGATATG
                      ____________________________________________________________
consensus GGTGCTGGAAGGTTTATTATAATTGCACTGTCACTTCCATCATATGCAGTTTAAGATATG
 
. : . : . : . : . : . :
rJMSF049E07+ CATAATATGAT
JMSF049E07- CATAATATGATTCCAGTAATGTATGAATAATTTTGTCATTCCAAAAAAAGAAAAAAAAAA
                      ____________________________________________________________
consensus CATAATATGATTCCAGTAATGTATGAATAATTTTGTCATTCCAAAAAAAGAAAAAAAAAA