Previous Contig 007907:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN031M19Sequence527007907 (3)gb:AF485267_18040703e-54Gossypium hirsutum class III peroxidase (pod5) mRNA, complete cds.
JMSF049E05Sequence639007907 (3)gb:AF485267_18040709e-35Gossypium hirsutum class III peroxidase (pod5) mRNA, complete cds.733007907 (3)gb:AF485267_18040705e-78Gossypium hirsutum class III peroxidase (pod5) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031M19+ ATAAATTATAATGATATATATATGTACCATGAG
                      ____________________________________________________________
consensus ATAAATTATAATGATATATATATGTACCATGAG
 
. : . : . : . : . : . :
JMFN031M19+ AATGAAGCTTAATTGGTTTTGTACATATAATAATGTAATATAATTAAATAATTAATTGAT
rJMSF049E05- ATTGGTTTTGTACATATAATAATGTAATATAATTAAATAATTAATTGAT
                      ____________________________________________________________
consensus AATGAAGCTTAATTGGTTTTGTACATATAATAATGTAATATAATTAAATAATTAATTGAT
 
. : . : . : . : . : . :
JMFN031M19+ CAATTAAAAGCTGCACATGAACGCCTAATTTTCCCTTGGGAGCCACTTAGAACACCAATT
rJMSF049E05- CAATTAAAAGCTGCACATGAACGCCTAATTTTCCCTTGGGAGCCACTTAGAACACCAATT
                      ____________________________________________________________
consensus CAATTAAAAGCTGCACATGAACGCCTAATTTTCCCTTGGGAGCCACTTAGAACACCAATT
 
. : . : . : . : . : . :
JMFN031M19+ CTTCCCATTTTCACCATGGCATCAGCGAAGTCGTCCTCGAACGACGGCCGGAGAAACGGC
rJMSF049E05- CTTCCCATTTTCACCATGGCATCAGCGAAGTCGTCCTCGAACGACGGCCGGAGAAACGGC
                      ____________________________________________________________
consensus CTTCCCATTTTCACCATGGCATCAGCGAAGTCGTCCTCGAACGACGGCCGGAGAAACGGC
 
. : . : . : . : . : . :
JMFN031M19+ AAACCGCCGAAGTAAGAATCCACGGCGTTCCTCGTTACGTCATCCTCGTACAGCCTCGCA
rJMSF049E05- AAACCGCCGAAGTAAGAATCCACGGCGTTCCTCGTTACGTCATCCTCGTACAGCCTCGCA
                      ____________________________________________________________
consensus AAACCGCCGAAGTAAGAATCCACGGCGTTCCTCGTTACGTCATCCTCGTACAGCCTCGCA
 
. : . : . : . : . : . :
JMFN031M19+ TCGGACTGCAACACTGCGAACCCACTCCTGATGTTCTGCAGAATTTGGCTGTCGAACGTT
rJMSF049E05- TCGGACTGCAACACTGCGAACCCACTCCTGATGTTCTGCAGAATTTGGCTGTCGAACGTT
                      ____________________________________________________________
consensus TCGGACTGCAACACTGCGAACCCACTCCTGATGTTCTGCAGAATTTGGCTGTCGAACGTT
 
. : . : . : . : . : . :
JMFN031M19+ TGGCCGCTGCCGTGGTCGATCGGTAACCGGACGTTGACGTCGCCGTTCTGCGGGCACGTC
rJMSF049E05- TGGCCGCTGCCGTGGTCGATCGGTAACCGGACGTTGACGTCGCCGTTCTGCGGGCACGTC
                      ____________________________________________________________
consensus TGGCCGCTGCCGTGGTCGATCGGTAACCGGACGTTGACGTCGCCGTTCTGCGGGCACGTC
 
. : . : . : . : . : . :
JMFN031M19+ GCCTTTAGCTCCGGCAGTAATTCGGGGCTTATCGACGGGTCGGAACCCCCGACGCCGGGG
rJMSF049E05- GCCTTTAGCTCCGGCAGTAATTCGGGGCTTATCGACNGGTCGGAACCCCCGACGCCGGGG
                      ____________________________________________________________
consensus GCCTTTAGCTCCGGCAGTAATTCGGGGCTTATCGACGGGTCGGAACCCCCGACGCCGGGG
 
. : . : . : . : . : . :
JMFN031M19+ AAGTTGTAGAGGCGATTGGTCATGAAGAAGCATGCCGTGGTTCCAATTGTGTGTGCAGCA
rJMSF049E05- AAGTTGTAGAGGCGATTGGTCATGAAGAAGCATGCCGTGGTTCCAATTGTGTGTGCAGCA
                      ____________________________________________________________
consensus AAGTTGTAGAGGCGATTGGTCATGAAGAAGCATGCCGTGGTTCCAATTGTGTGTGCAGCA
 
. : . : . : . : . : . :
JMFN031M19+ CTTAGGACAACAAG
rJMSF049E05- CTTAGGACAACAAGGTCATTTTCGGAAAGGCCTTTATTGATAAACTTGTTTTTAAGAGTT
                      ____________________________________________________________
consensus CTTAGGACAACAAGGTCATTTTCGGAAAGGCCTTTATTGATAAACTTGTTTTTAAGAGTT
 
. : . : . : . : . : . :
rJMSF049E05- TGAATTGAATCATCAATGTCTGGCATGTCGTCTGCCAGTGACAAATTGGAAACCATTCCA
                      ____________________________________________________________
consensus TGAATTGAATCATCAATGTCTGGCATGTCGTCTGCCAGTGACAAATTGGAAACCATTCCA
 
. : . : . : . : . : . :
rJMSF049E05- TCTCTTCTCCCCATTTCCACCCCGTACGACGGTCCATTTGCCAAAACGACAGCTTCTCTA
JMSF049E05+ CCGTACGACGGTCCATTTGCCAAAACGACAGCTTCTCTA
                      ____________________________________________________________
consensus TCTCTTCTCCCCATTTCCACCCCGTACGACGGTCCATTTGCCAAAACGACAGCTTCTCTA
 
. : . : . : . : . : . :
rJMSF049E05- GCTGCCAATGCTACAATATCAGCACAAGAAACAATTCCTGGACAAACCGCCTCCACTTCT
JMSF049E05+ GCTGCCAATGCTNCAATATCAGCACAAGAAACAATTCCTGGACAAACCGCCTCCACTTCT
                      ____________________________________________________________
consensus GCTGCCAATGCTACAATATCAGCACAAGAAACAATTCCTGGACAAACCGCCTCCACTTCT
 
. : . : . : . : . : . :
rJMSF049E05- GCCTTTGCTTTTTCTATCACCTCA
JMSF049E05+ GCCTNTGCTTTTTCTATCACCTCAAATCCCCCCACTCCTTGGTGCCCGAATGCATGCCTC
                      ____________________________________________________________
consensus GCCTTTGCTTTTTCTATCACCTCAAATCCCCCCACTCCTTGGTGCCCGAATGCATGCCTC
 
. : . : . : . : . : . :
JMSF049E05+ TCTGAAATCTCCCCATTATCAACCAATATCGACCCGTCACACCCCTGAACGAAGCAATCG
                      ____________________________________________________________
consensus TCTGAAATCTCCCCATTATCAACCAATATCGACCCGTCACACCCCTGAACGAAGCAATCG
 
. : . : . : . : . : . :
JMSF049E05+ TGGAAATGGAGGCGGAGCAAGACGGGAGCAATGTTAGCGTTGGAGGCGGCGACGTCGCGG
                      ____________________________________________________________
consensus TGGAAATGGAGGCGGAGCAAGACGGGAGCAATGTTAGCGTTGGAGGCGGCGACGTCGCGG
 
. : . : . : . : . : . :
JMSF049E05+ ATAACGCCGCCGACGATTGCTCCGACGTTAGGGCAACTGTCGTCGTAGAAACTCACGCTA
                      ____________________________________________________________
consensus ATAACGCCGCCGACGATTGCTCCGACGTTAGGGCAACTGTCGTCGTAGAAACTCACGCTA
 
. : . : . : . : . : . :
JMSF049E05+ AGCTGCCCTTGTGAAACCCCACTCAGATGACTCCAAATAGTAAGAACCAACACTATAGCT
                      ____________________________________________________________
consensus AGCTGCCCTTGTGAAACCCCACTCAGATGACTCCAAATAGTAAGAACCAACACTATAGCT
 
. : . : . : . : . : . :
JMSF049E05+ ATCATATTAATTAGTTGCAGATTTTATCTGTGATAATATATATGTATATCTGTTTCTTTA
                      ____________________________________________________________
consensus ATCATATTAATTAGTTGCAGATTTTATCTGTGATAATATATATGTATATCTGTTTCTTTA
 
. : . : . : . : . : . :
JMSF049E05+ GAGAAATAATGTTTNTAATTTGATTGAATATAGAGGAGATAGCTGCTAGTATATATATAT
                      ____________________________________________________________
consensus GAGAAATAATGTTTNTAATTTGATTGAATATAGAGGAGATAGCTGCTAGTATATATATAT
 
. : . : . : . : . : . :
JMSF049E05+ GTGTGTGAGAGAGAGAGGGGGAGAGAGAGAGAGAGATTGCTAGCTGATGAAGCTTATATA
                      ____________________________________________________________
consensus GTGTGTGAGAGAGAGAGGGGGAGAGAGAGAGAGAGATTGCTAGCTGATGAAGCTTATATA
 
. : . : . : . : . : . :
JMSF049E05+ TACAGAAGAAGAAAGATGGAAAGTGATTTGAAGAAAGAACAAGGAAGAAGGGGAGCTATC
                      ____________________________________________________________
consensus TACAGAAGAAGAAAGATGGAAAGTGATTTGAAGAAAGAACAAGGAAGAAGGGGAGCTATC