Previous Contig 007902:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002A23Sequence290007902 (3)pir|B86359|B863592e-18protein Similar to LeOPT1 [Lycopersicon esculentum] [imported] - Arabidopsis tha725011351 (4)gb:AK175547_18175356e-68Arabidopsis thaliana mRNA for putative peptide transporter PTR2-B, complete cds,
JMSF006O15Sequence209007902 (3)pir|B86359|B863597e-05protein Similar to LeOPT1 [Lycopersicon esculentum] [imported] - Arabidopsis tha386001804 (183)pir|S07942|CDKV4e-58chlorophyll a/b-binding protein precursor - cucumber (fragment)
JMSF049D16Sequence653007902 (3)pir|F86358|F863587e-61Similar to peptide transporter [imported] - Arabidopsis thaliana>gb:AE005172_891734011351 (4)gb:AK175547_18175352e-67Arabidopsis thaliana mRNA for putative peptide transporter PTR2-B, complete cds,

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049D16+ AGAACGAGCTTTTGGCTTTATTCTCTTGTGGGTCTTGTGTATCAAATTGGTCG
                      ____________________________________________________________
consensus AGAACGAGCTTTTGGCTTTATTCTCTTGTGGGTCTTGTGTATCAAATTGGTCG
 
. : . : . : . : . : . :
JMSF049D16+ GCTCCAAAAGCTTGCACACAAGGTTTGTGCCCACCTTGAGCTAGTCCCACGAGATACAGA
                      ____________________________________________________________
consensus GCTCCAAAAGCTTGCACACAAGGTTTGTGCCCACCTTGAGCTAGTCCCACGAGATACAGA
 
. : . : . : . : . : . :
JMSF049D16+ GAAAAGAAAAAGAAGATAATTTCAAACTGTGGAGGAGAACATGTGTCATTATTTGTAGCA
                      ____________________________________________________________
consensus GAAAAGAAAAAGAAGATAATTTCAAACTGTGGAGGAGAACATGTGTCATTATTTGTAGCA
 
. : . : . : . : . : . :
JMSF049D16+ TCTTGGCAGTTTGACGACTTGGAATGAAGTACGGCTGATAGGGTTAGGAAGCCCAAGCCC
                      ____________________________________________________________
consensus TCTTGGCAGTTTGACGACTTGGAATGAAGTACGGCTGATAGGGTTAGGAAGCCCAAGCCC
 
. : . : . : . : . : . :
JMSF049D16+ AGGATATATAGCACAGAGGCAGATATTATGGTCCGGTATCTACCCAGAAAAGAGCCGGCC
                      ____________________________________________________________
consensus AGGATATATAGCACAGAGGCAGATATTATGGTCCGGTATCTACCCAGAAAAGAGCCGGCC
 
. : . : . : . : . : . :
JMSF049D16+ ACAAATGCTCCCAATAGCGGCAAAAGCGACGCCGTTCCCGTCCAAGCATTCACATTCTCC
                      ____________________________________________________________
consensus ACAAATGCTCCCAATAGCGGCAAAAGCGACGCCGTTCCCGTCCAAGCATTCACATTCTCC
 
. : . : . : . : . : . :
JMSF002A23+ TCGCCGTGGACTGGCCGAGCGGCCCAGTCAGGTAGCTTATCAGGTTCAAACCT
JMSF049D16+ GCCGCCGTCGCCGTGGACTGGCCGAGCGGCCCAGTCAGGTAGCTTATCAGGTTCAAACCT
                      ____________________________________________________________
consensus GCCGCCGTCGCCGTGGACTGGCCGAGCGGCCCAGTCAGGTAGCTTATCAGGTTCAAACCT
 
. : . : . : . : . : . :
JMSF006O15+ TCTCCACGCCTATGATGAAATAAGCTGATCTC
JMSF002A23+ ATCCCATAGTACGCAAATCTCTCCGCCATCTCCACGCCTATGATGAAATAAGCTGATCTC
JMSF049D16+ ATCCCATAGTACGCAAATCTCTCCGCCATCTCCACGCCTATGATGAAATAAGCTGATCTC
                      ____________________________________________________________
consensus ATCCCATAGTACGCAAATCTCTCCGCCATCTCCACGCCTATGATGAAATAAGCTGATCTC
 
. : . : . : . : . : . :
JMSF006O15+ CAGCGACCCGATCTGGATCGGATGGCAGGTCGGCCCTTGTAATCGACGGAACCATCAACG
JMSF002A23+ CAGCGACCCGATCTGGATCGGATGGCAGGTCGGCCCTTGTAATCGACGGAACCATCAACG
JMSF049D16+ CAGCGACCCGATCTGGATCGGATGGCAGGTCGGCCCTTGTAATCGACGGAACCATCAACG
                      ____________________________________________________________
consensus CAGCGACCCGATCTGGATCGGATGGCAGGTCGGCCCTTGTAATCGACGGAACCATCAACG
 
. : . : . : . : . : . :
JMSF006O15+ GAATCGTGTTGCAGAAATTTGGTTTCGGCGTCTGGAAGGTCCATTGTTGCTCCGGTGATG
JMSF002A23+ GAATCGTGTTGCAGAAATTGGGTTTCGGCGTCTGGAAGGTCCATTGTTGCTCCGGTGATG
JMSF049D16+ GAATCGTGTTGCAGAAATTGGGTTTCGGCGTCTGGAAGGTCCATTGTTGCTCCGGTGATG
                      ____________________________________________________________
consensus GAATCGTGTTGCAGAAATTGGGTTTCGGCGTCTGGAAGGTCCATTGTTGCTCCGGTGATG
 
. : . : . : . : . : . :
JMSF006O15+ GCCATAGCCCATAGAGACGAGACCGCCACCACGCCCCTGCGGCACAAATCCACGA
JMSF002A23+ GCCATAGCCCATAGAGACGAGACCGCCACCACGCCCCTGCGGCACAAATCCACGA
JMSF049D16+ GCCATAGCCCATAGAGACGAGACCGCCACCACGCCCCTGCGGCACAAATCCACGATAACC
                      ____________________________________________________________
consensus GCCATAGCCCATAGAGACGAGACCGCCACCACGCCCCTGCGGCACAAATCCACGATAACC