Previous Contig 007895:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049C05Sequence698007895 (2)gb:AB122079_15280343e-39Panax ginseng mRNA for cytochrome P450, complete cds.763013809 (2)gb:AB122079_15280343e-72Panax ginseng mRNA for cytochrome P450, complete cds.
JMSF050K15Sequence676007895 (2)gb:AB122079_15280343e-39Panax ginseng mRNA for cytochrome P450, complete cds.733013809 (2)gb:AB122079_15280342e-69Panax ginseng mRNA for cytochrome P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050K15+ GTTAGGGAGAGCCGCCAAACTCATAGCTTCATGAATCACAGC
JMSF049C05+ GGGAGAGCCGCCAAACTCATAGCTTCATGAATCACAGC
                      ____________________________________________________________
consensus GTTAGGGAGAGCCGCCAAACTCATAGCTTCATGAATCACAGC
 
. : . : . : . : . : . :
JMSF050K15+ CTTGAAACCCTTGTCGCCGATGTCTTTATCCTCGTACTTCTTCCCAAACACCATCCGACA
JMSF049C05+ CTTGAAACCCTTGTCGCCGATGTCTTTATCCTCGTACTTCTTCCCAAACACCATCCGACA
                      ____________________________________________________________
consensus CTTGAAACCCTTGTCGCCGATGTCTTTATCCTCGTACTTCTTCCCAAACACCATCCGACA
 
. : . : . : . : . : . :
JMSF050K15+ GCTCATCTCGGCACTCATGGAAGCAACTTTGGCACTCAAATCAACGGCGCCGCCATTTCT
JMSF049C05+ GCTCATCTCGGCACTCATGGAAGCAACTTTGGCACTCAAATCAACGGCGCCGCCATTTCT
                      ____________________________________________________________
consensus GCTCATCTCGGCACTCATGGAAGCAACTTTGGCACTCAAATCAACGGCGCCGCCATTTCT
 
. : . : . : . : . : . :
JMSF050K15+ AGACGCCTGCTTCAGTGACTCTACCAGAAGGCACACCTCTTCCCTTCTCATGGACTGAAA
JMSF049C05+ AGACGCCTGCTTCAGTGACTCTACCAGAAGGCACACCTCTTCCCTTCTCATGGACTGAAA
                      ____________________________________________________________
consensus AGACGCCTGCTTCAGTGACTCTACCAGAAGGCACACCTCTTCCCTTCTCATGGACTGAAA
 
. : . : . : . : . : . :
JMSF050K15+ CGAATTGATCTTGTGATTGCTGAGGAGCTCTAAGGTACATAGCTTTCGCATGTTGCGCCA
JMSF049C05+ CGAATTGATCTTGTGATTGCTGAGGAGCTCTAAGGTACATAGCTTTCGCATGTTGCGCCA
                      ____________________________________________________________
consensus CGAATTGATCTTGTGATTGCTGAGGAGCTCTAAGGTACATAGCTTTCGCATGTTGCGCCA
 
. : . : . : . : . : . :
JMSF050K15+ GTACGGACCGTACTCGCCAAACGACAAATTCTTCTGGTTATACGACATGTACTTGGCCGC
JMSF049C05+ GTACGGACCGTACTCGCCAAACGACAAATTCTTCTGGTTATACGACATGTACTTGGCCGC
                      ____________________________________________________________
consensus GTACGGACCGTACTCGCCAAACGACAAATTCTTCTGGTTATACGACATGTACTTGGCCGC
 
. : . : . : . : . : . :
JMSF050K15+ CTGGTGCGGCGGCCTGGTGGCGAACACAAGATCATGCGTCTTCAGGAATTGCTCGGCGGC
JMSF049C05+ CTGGTGCGGCGGCCTGGTGGCGAACACAAGATCATGCGTCTTCAGGAATTGCTCGGCGGC
                      ____________________________________________________________
consensus CTGGTGCGGCGGCCTGGTGGCGAACACAAGATCATGCGTCTTCAGGAATTGCTCGGCGGC
 
. : . : . : . : . : . :
JMSF050K15+ TTCAGCTGATGAAACGATGATGTTGTCGACAAACCCAAACCTTAAATGCATAATCGGACC
JMSF049C05+ TTCAGCTGATGAAACGATGATGTTGTCGACAAACCCAAACCTTAAATGCATAATCGGACC
                      ____________________________________________________________
consensus TTCAGCTGATGAAACGATGATGTTGTCGACAAACCCAAACCTTAAATGCATAATCGGACC
 
. : . : . : . : . : . :
JMSF050K15+ GTGGGTTTTGGCCAGTTCATGCAAATCTTGATGGGGATTTTTCCCGATCAAATGGAGGTG
JMSF049C05+ GTGGGTTTTGGCCAGTTCATGCAAATCTTGATGGGGATTTTTCCCGATCAAATGGAGGTG
                      ____________________________________________________________
consensus GTGGGTTTTGGCCAGTTCATGCAAATCTTGATGGGGATTTTTCCCGATCAAATGGAGGTG
 
. : . : . : . : . : . :
JMSF050K15+ TCCCAATATCGGCAGCCCTTTGGGACCAGGCGGCAACCTTTTACTTCTGTTCTTCAGGAA
JMSF049C05+ TCCCAATATCGGCAGCCCTTTGGGACCAGGCGGCAACCTTTTACTTCTGTTCTTCAGGAA
                      ____________________________________________________________
consensus TCCCAATATCGGCAGCCCTTTGGGACCAGGCGGCAACCTTTTACTTCTGTTCTTCAGGAA
 
. : . : . : . : . : . :
JMSF050K15+ TCCACTGAAAAAAGAAACCGCGGCAATCACGGCAATGGCTGCCAAAATCCATGCGGTGTT
JMSF049C05+ TCCACTGAAAAAAGAAACCGCGGCAATCACGGCAATGGCTGCCAAAATCCATGCGGTGTT
                      ____________________________________________________________
consensus TCCACTGAAAAAAGAAACCGCGGCAATCACGGCAATGGCTGCCAAAATCCATGCGGTGTT
 
. : . : . : . : . : . :
JMSF050K15+ CATCATGGTTTTAGTGCAGTGTTCTCAAGTAC
JMSF049C05+ CATCATGGTTTTAGTGCAGTGTTCTCAAGTACGTGAAAATGAATGCAGAATGCATGCATC
                      ____________________________________________________________
consensus CATCATGGTTTTAGTGCAGTGTTCTCAAGTACGTGAAAATGAATGCAGAATGCATGCATC