Previous Contig 007894:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012O09Sequence310007894 (2)762011714 (8)sp|P49730|RIR2_TOBACe-100Ribonucleoside-diphosphate reductase small chain (EC 1.17.4.1) (Ribonucleotide r
JMSF049B19Sequence650007894 (2)gb:AC007070_15351609e-32Arabidopsis thaliana chromosome 2 clone T22F11 map GPA1, complete sequence.781024344gb:AK175874_18178621e-35Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049B19+ TCTTAGATCATAAGATAGAGTTATAAAATCACTAAATCTTCGTTGTATTC
                      ____________________________________________________________
consensus TCTTAGATCATAAGATAGAGTTATAAAATCACTAAATCTTCGTTGTATTC
 
. : . : . : . : . : . :
JMSF049B19+ CCCTTGTAGTTGTAATTCCTTGTGGTGATTGTATTCCGACAAGAACCTCGTAAAGCACCA
                      ____________________________________________________________
consensus CCCTTGTAGTTGTAATTCCTTGTGGTGATTGTATTCCGACAAGAACCTCGTAAAGCACCA
 
. : . : . : . : . : . :
JMSF049B19+ CAGATTCTGAAGCACTGGACTCTGACGATAGTTTCCAAGAAGGTATTGTAACGCAATAAC
                      ____________________________________________________________
consensus CAGATTCTGAAGCACTGGACTCTGACGATAGTTTCCAAGAAGGTATTGTAACGCAATAAC
 
. : . : . : . : . : . :
JMSF049B19+ TCCATCCTGTGTGAAAGTCATGAGGCCACACACTGTTTTGTCCATCCCAAACACGAGGTG
                      ____________________________________________________________
consensus TCCATCCTGTGTGAAAGTCATGAGGCCACACACTGTTTTGTCCATCCCAAACACGAGGTG
 
. : . : . : . : . : . :
JMSF012O09+ CAGGGGAAGCGGCGAAGTGCCGTCGTGGCGGTGCCTCGGTG
JMSF049B19+ GAGGACTCCAGTCCATGCCCAGGGGAAGCGGCGAAGTGCCGTCGTGGCGGTGCCTCGGTG
                      ____________________________________________________________
consensus GAGGACTCCAGTCCATGCCCAGGGGAAGCGGCGAAGTGCCGTCGTGGCGGTGCCTCGGTG
 
. : . : . : . : . : . :
JMSF012O09+ GACTCGCATCCCTATTACCAGAGGATAGCCCCGTCAGAGCTCCAAGTCCGGGAAAACCGC
JMSF049B19+ GACTCGCATCCCTATTACCAGAGGATAGCCCCGTCAGAGCTCCAAGTCCGGGAAAACCGC
                      ____________________________________________________________
consensus GACTCGCATCCCTATTACCAGAGGATAGCCCCGTCAGAGCTCCAAGTCCGGGAAAACCGC
 
. : . : . : . : . : . :
JMSF012O09+ CGGCGGTAACCTGCGGATGGTTGTAAAGGTTGAGAGACTCGATGATGGCGGGATCGGTGA
JMSF049B19+ CGGCGGTAACCTGCGGATGGTTGTAAAGGTTGAGAGACTCGATGATGGCGGGATCGGTGA
                      ____________________________________________________________
consensus CGGCGGTAACCTGCGGATGGTTGTAAAGGTTGAGAGACTCGATGATGGCGGGATCGGTGA
 
. : . : . : . : . : . :
JMSF012O09+ GTCCCAAGTCGAAGAGAGTGTAGGGCCCGTACATGTTCGTCATCATCGTTGCAGTCGTCG
JMSF049B19+ GTCCCAAGTCGAAGAGAGTGTAGGGCCCGTACATGTTCGTCATCATCGTTGCAGTCGTCG
                      ____________________________________________________________
consensus GTCCCAAGTCGAAGAGAGTGTAGGGCCCGTACATGTTCGTCATCATCGTTGCAGTCGTCG
 
. : . : . : . : . : . :
JMSF012O09+ GCGGCGGAGACTGAGTGTTCGCTTCGGTTTCGACGGGAAGAAATACTCTTCGCGGCTCAC
JMSF049B19+ GCGGCGGAGACTGAGTGTTCGCTTCGGTTTCGACGGGAAGAAATACTCTTCGCGGCTCAC
                      ____________________________________________________________
consensus GCGGCGGAGACTGAGTGTTCGCTTCGGTTTCGACGGGAAGAAATACTCTTCGCGGCTCAC
 
. : . : . : . : . : . :
JMSF012O09+ CTAACGGTCGAGTTAGTTGTGCAGAG
JMSF049B19+ CTAACGGTCGAGTTAGTTGTGCAGAGTCAATTGACTTGTGCTCGAAGAAGACGATAACGC
                      ____________________________________________________________
consensus CTAACGGTCGAGTTAGTTGTGCAGAGTCAATTGACTTGTGCTCGAAGAAGACGATAACGC
 
. : . : . : . : . : . :
JMSF049B19+ ATCGCGGATGTTGTTCACTGTGCTTCTACATGTGTACCGTTGTGATTTGTGAATCAAACC
                      ____________________________________________________________
consensus ATCGCGGATGTTGTTCACTGTGCTTCTACATGTGTACCGTTGTGATTTGTGAATCAAACC