Previous Contig 007893:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF029L04Sequence631007893 (3)pir|H84482|H844823e-64hypothetical protein At2g07170 [imported] - Arabidopsis thaliana>gb:AC005693_153726014020 (3)pir|H84482|H844821e-27hypothetical protein At2g07170 [imported] - Arabidopsis thaliana>gb:AC005693_153
JMSF049B18Sequence709007893 (3)pir|H84482|H844824e-64hypothetical protein At2g07170 [imported] - Arabidopsis thaliana>gb:AC005693_153780014020 (3)pir|H84482|H844821e-27hypothetical protein At2g07170 [imported] - Arabidopsis thaliana>gb:AC005693_153
JMSF052K09Sequence667007893 (3)pir|H84482|H844821e-63hypothetical protein At2g07170 [imported] - Arabidopsis thaliana>gb:AC005693_153832014020 (3)pir|H84482|H844822e-28hypothetical protein At2g07170 [imported] - Arabidopsis thaliana>gb:AC005693_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052K09+ TGCAAAACCAATGTAGGGGGATTTTGGATACTGTCTATGACCCGGGC
JMSF029L04+ TGCAAAACCAATGTAGGGGGATTTTGGATACTGTCTATGACCCGGGC
JMSF049B18+ TCTGCAAAACCAATGTAGGGGGATTTTGGATACTGTCTATGACCCGGGC
                      ____________________________________________________________
consensus TCTGCAAAACCAATGTAGGGGGATTTTGGATACTGTCTATGACCCGGGC
 
. : . : . : . : . : . :
JMSF052K09+ CAAGCACAGTGCCGAACCAGATTGCACCTGCTTATTTTGCTCTCCCAATGCCTCAAAAAG
JMSF029L04+ CAAGCACAGTGCCGAACCAGATTGCACCTGCTTATTTTGCTCTCCCAATGCCTCAAAAAG
JMSF049B18+ CAAGCACAGTGCCGAACCAGATTGCACCTGCTTATTTTGCTCTCCCAATGCCTCAAAAAG
                      ____________________________________________________________
consensus CAAGCACAGTGCCGAACCAGATTGCACCTGCTTATTTTGCTCTCCCAATGCCTCAAAAAG
 
. : . : . : . : . : . :
JMSF052K09+ AGGCCTAACTAGGACAATAAAAACTCCATCGTTCTCATTGTCAGTGCCAAAACAACCAAG
JMSF029L04+ AGGCCTAACTAGGACAATAAAAACTCCATCGTTCTCATTGTCAGTGCCAAAACAACCAAG
JMSF049B18+ AGGCCTAACTAGGACAATAAAAACTCCATCGTTCTCATTGTCAGTGCCAAAACAACCAAG
                      ____________________________________________________________
consensus AGGCCTAACTAGGACAATAAAAACTCCATCGTTCTCATTGTCAGTGCCAAAACAACCAAG
 
. : . : . : . : . : . :
JMSF052K09+ TTTAGCAGCCAAAACACCAACTGTCTCAACACAAGCATCTCTTACAACAGAATCTGAATC
JMSF029L04+ TTTAGCAGCCAAAACACCAACTGTCTCAACACAAGCATCTCTTACAACAGAATCTGAATC
JMSF049B18+ TTTAGCAGCCAAAACACCAACTGTCTCAACACAAGCATCTCTTACAACAGAATCTGAATC
                      ____________________________________________________________
consensus TTTAGCAGCCAAAACACCAACTGTCTCAACACAAGCATCTCTTACAACAGAATCTGAATC
 
. : . : . : . : . : . :
JMSF052K09+ CTTCAGCCGTTTAACAATGCTGGCTACCATCTTTGCAAGATGCGGGCCGACAAGGTTGTC
JMSF029L04+ CTTCAGCCGTTTAACAATGCTGGCTACCATCTTTGCAAGATGCGGGCCGACAAGGTTGTC
JMSF049B18+ CTTCAGCCGTTTAACAATGCTGGCTACCATCTTTGCAAGATGCGGGCCGACAAGGTTGTC
                      ____________________________________________________________
consensus CTTCAGCCGTTTAACAATGCTGGCTACCATCTTTGCAAGATGCGGGCCGACAAGGTTGTC
 
. : . : . : . : . : . :
JMSF052K09+ ATGGAGGCTGGCTAGGGAGCCCATTAATCGAATGCATTCCTTACGAACAGCACTTTTCTG
JMSF029L04+ ATGGAGGCTGGCTAGGGAGCCCATTAATCGAATGCATTCCTTACGAACAGCACTTTTCTG
JMSF049B18+ ATGGAGGCTGGCTAGGGAGCCCATTAATCGAATGCATTCCTTACGAACAGCACTTTTCTG
                      ____________________________________________________________
consensus ATGGAGGCTGGCTAGGGAGCCCATTAATCGAATGCATTCCTTACGAACAGCACTTTTCTG
 
. : . : . : . : . : . :
JMSF052K09+ TTCTGAATCTGTATCTAATATGCAAGACAGAAATGGGGTAATCCCATTTGGGGTCAAGCA
JMSF029L04+ TTCTGAATCTGTATCTAATATGCAAGACAGAAATGGGGTAATCCCATTTGGGGTCAAGCA
JMSF049B18+ TTCTGAATCTGTATCTAATATGCAAGACAGAAATGGGGTAATCCCATTTGGGGTCAAGCA
                      ____________________________________________________________
consensus TTCTGAATCTGTATCTAATATGCAAGACAGAAATGGGGTAATCCCATTTGGGGTCAAGCA
 
. : . : . : . : . : . :
JMSF052K09+ CTCAATAATTTTCTCAAGTTCCTCCACAGCAATTTGATACGTATCCCTATCAGCAAGTTT
JMSF029L04+ CTCAATAATTTTCTCAAGTTCCTCCACAGCAATTTGATACGTATCCCTATCAGCAAGTTT
JMSF049B18+ CTCAATAATTTTCTCAAGTTCCTCCACAGCAATTTGATACGTATCCCTATCAGCAAGTTT
                      ____________________________________________________________
consensus CTCAATAATTTTCTCAAGTTCCTCCACAGCAATTTGATACGTATCCCTATCAGCAAGTTT
 
. : . : . : . : . : . :
JMSF052K09+ GTTCAGTGCAATAACTACGCGTTGCTTAAGTTCAAAAACAGCCTGATGGCTGTTCTTTGC
JMSF029L04+ GTTCAGTGCAATAACTACGCGTTGCTTAAGTTCAAAAACAGCCTGATGGCTGTTCTTTGC
JMSF049B18+ GTTCAGTGCAATAACTACGCGTTGCTTAAGTTCAAAAACAGCCTGATGGCTGTTCTTTGC
                      ____________________________________________________________
consensus GTTCAGTGCAATAACTACGCGTTGCTTAAGTTCAAAAACAGCCTGATGGCTGTTCTTTGC
 
. : . : . : . : . : . :
JMSF052K09+ GTTTCCTTTCCCTTTCACCATATTTTCATGCGTCTTCATTTCGTAGTTTATTCACTGCCA
JMSF029L04+ GTTTCCTTTCCCTTTCACCATATTTTCATGCGTCTTCATTTCGTAGTTTATTCACTGCCA
JMSF049B18+ GTTTCCTTTCCCTTTCACCATATTTTCATGCGTCTTCATTTCGTAGTTTATTCACTGCCA
                      ____________________________________________________________
consensus GTTTCCTTTCCCTTTCACCATATTTTCATGCGTCTTCATTTCGTAGTTTATTCACTGCCA
 
. : . : . : . : . : . :
JMSF052K09+ TAGCCTGCCGGCTTCAACTTTCACGTTCCCCCTACAACTTCAAATTCTCCCTATCTCTCT
JMSF029L04+ TAGCCTGCCGGCTTCAACTTTCACGTTCCCCCTACAACTT
JMSF049B18+ TAGCCTGCCGGCTTCAACTTTCACGTTCCCCCTACAACTTCAAATTCTCCCTATCTCTCT
                      ____________________________________________________________
consensus TAGCCTGCCGGCTTCAACTTTCACGTTCCCCCTACAACTTCAAATTCTCCCTATCTCTCT
 
. : . : . : . : . : . :
JMSF052K09+ CGCACTCGCACAGAAGAAG
JMSF049B18+ CGCACTCGCACAGAAGAAGAGGTAAGCGGTGGGGAGTCGGGGTTTAAGTTTTGGCGCTCC
                      ____________________________________________________________
consensus CGCACTCGCACAGAAGAAGAGGTAAGCGGTGGGGAGTCGGGGTTTAAGTTTTGGCGCTCC