Previous Contig 007891:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN041K04Sequence524007891 (4)
JMFN041K06Sequence529007891 (4)
JMSF049B14Sequence588007891 (4)540007891 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN041K04+ AATTTCCAT
JMFN041K06+ AATTTCCAT
JMSF049B14+ TTTTTTTTTTGTTTTTTTGAATAGAAAAGGACAAATATTTTAATTTCCAT
                      ____________________________________________________________
consensus TTTTTTTTTTGTTTTTTTGAATAGAAAAGGACAAATATTTTAATTTCCAT
 
. : . : . : . : . : . :
rJMSF049B14- ACATTTCAGCCTTGGTAAGGTCCACAAAATTTTAAAAAAACAACACTCAAACAAATTCTA
JMFN041K04+ ACATTTCAGCCTT-GTAA-GTCCACAAAATTTTAAAAAAACAACACTCAAACAAATTCTA
JMFN041K06+ ACATTTCAGCCTT-GTAA-GTCCACAAAATTTTAAAAAAACAACACTCAAACAAATTCTA
JMSF049B14+ ACATTTCAGCCTT-GTAA-GTCCACAAAATTTTAAAAAAACAACACTCAAACAAATTCTA
                      ____________________________________________________________
consensus ACATTTCAGCCTT-GTAA-GTCCACAAAATTTTAAAAAAACAACACTCAAACAAATTCTA
 
. : . : . : . : . : . :
rJMSF049B14- CACAACATCCTACCAAGACAAGACTACACATATACTTCCCAGACAAATTTCGCCTGACGT
JMFN041K04+ CACAACATCCTACCAAGACAAGACTACACATATACTTCCCAGACAAATTTCGCCTGACGT
JMFN041K06+ CACAACATCCTACCAAGACAAGACTACACATATACTTCCCAGACAAATTTCGCCTGACGT
JMSF049B14+ CACAACATCCTACCAAGACAAGACTACACATATACTTCCCAGACAAATTTCGCCTGACGT
                      ____________________________________________________________
consensus CACAACATCCTACCAAGACAAGACTACACATATACTTCCCAGACAAATTTCGCCTGACGT
 
. : . : . : . : . : . :
rJMSF049B14- ATATGACACATTAAGCGAAATTTCTTTCAGACGAGAGAGTATCTCGAGGAATTTCTAATG
JMFN041K04+ ATATGACACATTAAGCGAAATTTCTTTCAGACGAGAGAGTATCTCGAGGAATTTCTAATG
JMFN041K06+ ATATGACACATTAAGCGAAATTTCTTTCAGACGAGAGAGTATCTCGAGGAATTTCTAATG
JMSF049B14+ ATATGACACATTAAGCGAAATTTCTTTCAGACGAGAGAGTATCTCGAGGAATTTCTAATG
                      ____________________________________________________________
consensus ATATGACACATTAAGCGAAATTTCTTTCAGACGAGAGAGTATCTCGAGGAATTTCTAATG
 
. : . : . : . : . : . :
rJMSF049B14- ACGATCGAGTGTATGTATAGGCGGTACATACAGGACTAGCGGGCGGCACCGGAGATGGTG
JMFN041K04+ ACGATCGAGTGTATGTATAGGCGGTACATACAGGACTAGCGGGCGGCACCGGAGATGGTG
JMFN041K06+ ACGATCGAGTGTATGTATAGGCGGTACATACAGGACTAGCGGGCGGCACCGGAGATGGTG
JMSF049B14+ ACGATCGAGTGTATGTATAGGCGGTACATACAGGACTAGCGGGCGGCACCGGAGATGGTG
                      ____________________________________________________________
consensus ACGATCGAGTGTATGTATAGGCGGTACATACAGGACTAGCGGGCGGCACCGGAGATGGTG
 
. : . : . : . : . : . :
rJMSF049B14- GGTTGGTGGGGGGAGGTGGGGGCACAAGCAATGCAAGCAAGCAAGAGGATGGCAGAAGAA
JMFN041K04+ GGTTGGTGGGGGGAGGTGGGGGCACAAGCAATGCAAGCAAGCAAGAGGATGGCAGAAGAA
JMFN041K06+ GGTTGGTGGGGGGAGGTGGGGGCACAAGCAATGCAAGCAAGCAAGAGGATGGCAGAAGAA
JMSF049B14+ GGTTGGTGGGGGGAGGTGGGGGCACAAGCAATGCAAGCAAGCAAGAGGATGGCAGAAGAA
                      ____________________________________________________________
consensus GGTTGGTGGGGGGAGGTGGGGGCACAAGCAATGCAAGCAAGCAAGAGGATGGCAGAAGAA
 
. : . : . : . : . : . :
rJMSF049B14- GCACCATCTTCTTGGAGATCAGAGAAGCTCCTCTTGAACTTGTGGCCTCTCCCTTTGTTC
JMFN041K04+ GCACCATCTTCTTGGAGATCAGAGAAGCTCCTCTTGAACTTGTGGCCTCTCCCTTTGTTC
JMFN041K06+ GCACCATCTTCTTGGAGATCAGAGAAGCTCCTCTTGAACTTGTGGCCTCTCCCTTTGTTC
JMSF049B14+ GCACCATCTTCTTGGAGATCAGAGAAGCTCCTCTTGAACTTGTGGCCTCTCCCTTTGTTC
                      ____________________________________________________________
consensus GCACCATCTTCTTGGAGATCAGAGAAGCTCCTCTTGAACTTGTGGCCTCTCCCTTTGTTC
 
. : . : . : . : . : . :
rJMSF049B14- AATATTATGCCTTGTACCTTGTTGTGTACTTGAGTAGTGTTCACTCCTTCTTGTTGCTGC
JMFN041K04+ AATATTATGCCTTGTACCTTGTTGTGTACTTGAGTAGTGTTCACTCCTTCTTGTTGCTGC
JMFN041K06+ AATATTATGCCTTGTACCTTGTTGTGTACTTGAGTAGTGTTCACTCCTTCTTGTTGCTGC
JMSF049B14+ AATATTATGCCTTGTACCTTGTTGTGTACTTGAGTAGTGTTCACTCCTTCTTGTTGCTGC
                      ____________________________________________________________
consensus AATATTATGCCTTGTACCTTGTTGTGTACTTGAGTAGTGTTCACTCCTTCTTGTTGCTGC
 
. : . : . : . : . : . :
rJMSF049B14- CTTGTCTTGTTTGCTTCTTCCACCCTAGACACCATCTTTTTTGCTTCTATAATTTAATTT
JMFN041K04+ CTTGTCTTGTTTGCCTCTTCCACCCTAGACACCATCTTTTTTGCTTCTATAATTTAATTT
JMFN041K06+ CTTGTCTTGTTTGCCTCTTCCACCCTAGACACCATCTTTTTTGCTTCTATAATTTAATTT
JMSF049B14+ CTTGTCTTGTTTGCTTCTTCCACCCTAGACACCATCTTTTTTGCTTCTATAATTTAATTT
                      ____________________________________________________________
consensus CTTGTCTTGTTTGCTTCTTCCACCCTAGACACCATCTTTTTTGCTTCTATAATTTAATTT
 
. : . : . : . : . : . :
rJMSF049B14- CAGAGAGAGAGAGAGAGAGACAAAGAGAGAGAGAGAGAGATGAAGGTAAGTGTGTGCATC
JMFN041K04+ CAGAGAGAGAGAGAGAGAGACAAAGAGAGAGAGAGAG
JMFN041K06+ CAGAGAGAGAGAGAGAGAGACAAAGAGAGAGAGAGAG
JMSF049B14+ CAGAGAGAGAGAGAGAGAGACAAAGAGAGAGAGAGAGAGATGAAGGTAAGTGTGTGCATC
                      ____________________________________________________________
consensus CAGAGAGAGAGAGAGAGAGACAAAGAGAGAGAGAGAGAGATGAAGGTAAGTGTGTGCATC