Previous Contig 007887:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002J10Sequence543007887 (7)gb:ATAC012328_15434094e-15Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFF037A21Sequence509007887 (7)gb:ATAC012328_15434095e-07Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen743012258 (5)gb:ATAC012328_15434094e-37Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFS008A05Sequence607007887 (7)gb:ATAC012328_15434096e-33Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFS078C04Sequence627007887 (7)gb:ATAC012328_15434095e-21Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMFS160E02Sequence434007887 (7)gb:ATAC012328_15434092e-10Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMSF022H20Sequence653007887 (7)gb:ATAC012328_15434092e-20Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen788012258 (5)gb:ATAC012328_15434095e-42Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen
JMSF049B02Sequence679007887 (7)gb:ATAC012328_15434092e-20Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen719012258 (5)gb:ATAC012328_15434097e-28Arabidopsis thaliana chromosome III BAC T17B22 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS160E02+ ACCAA
JMFS008A05+ GATTGCCATTATGAGGCGTCGATACCAA
                      ____________________________________________________________
consensus GATTGCCATTATGAGGCGTCGATACCAA
 
. : . : . : . : . : . :
JMFS160E02+ AGAGCTTTCCAACAGGCAACTGAAAAGCAAACCGTTCTTTGTGTGCATTGGCCTGCAACC
JMFS008A05+ AGAGCTTTCCAACAGGCAACTGAAAAGCAAACCGTTCTTTGTGTGCATTGGCCTGCAACC
                      ____________________________________________________________
consensus AGAGCTTTCCAACAGGCAACTGAAAAGCAAACCGTTCTTTGTGTGCATTGGCCTGCAACC
 
. : . : . : . : . : . :
JMFS160E02+ ATGTCTAGAACTACAAGAATCTGAATGCCTATGTTCCGGTTTTTGGTACGAAAATAACAC
JMFS008A05+ ATGTCTAGAACTACAAGAATCTGAATGCCTATGTTCCGGTTTTTGGTACGAAAATAACAC
                      ____________________________________________________________
consensus ATGTCTAGAACTACAAGAATCTGAATGCCTATGTTCCGGTTTTTGGTACGAAAATAACAC
 
. : . : . : . : . : . :
JMFS160E02+ CGAGGAAATAATGTTCCAATCGATCTTTGGAACATCACTCGGGTCCATCGATGATGGGAG
JMFS008A05+ CGAGGAAATAATGTTCCAATCGATCTTTGGAACATCACTCGGGTCCATCGATGATGGGAG
JMFS078C04+ ATGTTCCAATCGATCTTTGGAACATCACTCGGGTCCATCGATGATGGGAG
JMSF022H20+ TCGGGTCCATCGATGATGGGAG
JMSF049B02+ GGAACATCACTCGGGTCCATCGATGATGGGAG
                      ____________________________________________________________
consensus CGAGGAAATAATGTTCCAATCGATCTTTGGAACATCACTCGGGTCCATCGATGATGGGAG
 
. : . : . : . : . : . :
JMFS160E02+ AAGGAGATAATCAATAACTGCAGAACCATCAACCAGATTTAATCTGCCCAATGCTTCGTC
JMFS008A05+ AAGGAGATAATCAATAACTGCAGAACCATCAACCAGATTTAATCTGCCCAATGCTTCGTC
JMFF002J10+ TAATCTGCCCAATGCTTCGTC
JMFS078C04+ AAGGAGATAATCAATAACTGCAGAACCATCAACCAGATTTAATCTGCCCAATGCTTCGTC
JMSF022H20+ AAGGAGATAATCAATAACTGCAGAACCATCAACCAGATTTAATCTGCCCAATGCTTCGTC
JMSF049B02+ AAGGAGATAATCAATAACTGCAGAACCATCAACCAGATTTAATCTGCCCAATGCTTCGTC
                      ____________________________________________________________
consensus AAGGAGATAATCAATAACTGCAGAACCATCAACCAGATTTAATCTGCCCAATGCTTCGTC
 
. : . : . : . : . : . :
JMFS160E02+ GAGTGT-CCCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
JMFS008A05+ GAGTGTATTCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
JMFF002J10+ GAGTGTATTCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
JMFS078C04+ GAGTGTATTCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
JMSF022H20+ GAGTGTATTCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
JMSF049B02+ GAGTGTATTCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
                      ____________________________________________________________
consensus GAGTGTATTCAGATTATGCTCGAATAAAACTCTAAGAACAGTTACTTGAAACCTCCGACA
 
. : . : . : . : . : . :
JMFS160E02+ CCTAAGTAT
JMFS008A05+ CCTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
JMFF002J10+ CCTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
JMFS078C04+ CCTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
JMFF037A21+ CTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
JMSF022H20+ CCTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
JMSF049B02+ CCTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
                      ____________________________________________________________
consensus CCTAAGTATTTGTTCGTTAGATAGTCCAACATCCCCAATGTACACTGTCTGGCCTACCCA
 
. : . : . : . : . : . :
JMFS008A05+ GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
JMFF002J10+ GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
JMFS078C04+ GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
JMFF037A21+ GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
JMSF022H20+ GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
JMSF049B02+ GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
                      ____________________________________________________________
consensus GTTGCCTCCCTCAATGTTCAACTCAAAAGACAAATTCTCGTCATCAGATTCAAGCCTTGT
 
. : . : . : . : . : . :
JMFS008A05+ CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
JMFF002J10+ CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
JMFS078C04+ CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
JMFF037A21+ CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
JMSF022H20+ CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
JMSF049B02+ CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
                      ____________________________________________________________
consensus CCTCAAAGCAAGGATTATGTTTTGAAGCTGAGTTCTCTTATAATAGTACCGGTTAAGCTC
 
. : . : . : . : . : . :
JMFS008A05+ AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTTCAGG
JMFF002J10+ AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTCCAGG
JMFS078C04+ AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTTCAGG
JMFF037A21+ AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTTCAGG
JMSF022H20+ AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTTCAGG
JMSF049B02+ AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTTCAGG
                      ____________________________________________________________
consensus AATGAGGTAGCAAGAGTATAATGTTTGAGGAGCATTGTCTCTAGTACCAACAAGTTCAGG
 
. : . : . : . : . : . :
JMFS008A05+ TGGGAAGTACTTTGGTTGACATCCTAATT
JMFF002J10+ TGGGAAGTACTTTGGTTGACATCCTAATTCTTGATATGGAGGAGGATCTGATTGGAGCCC
JMFS078C04+ TGGGAAGTACTTTGGTTGACATCCTAATTCTTGATATGGAGGAGGATCTGATTGGAGCCC
JMFF037A21+ TGGGAAGTACTTTGGTTGACATCCTAATTCTTGATATGGAGGAGGATCTGATTGGAGCCC
JMSF022H20+ TGGGAAGTACTTTGGTTGACATCCTAATTCTTGATATGGAGGAGGATCTGATTGGAGCCC
JMSF049B02+ TGGGAAGTACTTTGGTTGACATCCTAATTCTTGATATGGAGGAGGATCTGATTGGAGCCC
                      ____________________________________________________________
consensus TGGGAAGTACTTTGGTTGACATCCTAATTCTTGATATGGAGGAGGATCTGATTGGAGCCC
 
. : . : . : . : . : . :
JMFF002J10+ TGTTGATCCAGTGGTGGCCATATCAAATCTCTGCATCCAGACATCCAGTACTATATCTTT
JMFS078C04+ TGTTGATCCAGTGGTGGCCATATCAAATCTCTGCATCCAGACATCCAGTACTATATCTTT
JMFF037A21+ TGTTGATCCAGTGGTGGCCATATCAAATCTCTGCATCCAGACATCCAGTACTATATCTTT
JMSF022H20+ TGTTGATCCAGTGGTGGCCATATCAAATCTCTGCATCCAGACATCCAGTACTATATCTTT
JMSF049B02+ TGTTGATCCAGTGGTGGCCATATCAAATCTCTGCATCCAGACATCCAGTACTATATCTTT
                      ____________________________________________________________
consensus TGTTGATCCAGTGGTGGCCATATCAAATCTCTGCATCCAGACATCCAGTACTATATCTTT
 
. : . : . : . : . : . :
JMFF002J10+ CACTCTTTGGTGGATAGATCAAATTAAAGTTGGATTCTTGTTTCTTGATCAGTTATATGC
JMFS078C04+ CAC---------------TCAAATTAAAGTTGGATTCTTGTTTCTTGATCAGTTATATGC
JMFF037A21+ CAC---------------TCAAATTAAAGTTGGATTCTTGTTTCTTGATCAGTTATATGC
JMSF022H20+ CAC---------------TCAAATTAAAGTTGGATTCTTGTTTCTTGATCAGTTATATGC
JMSF049B02+ CAC---------------TCAAATTAAAGTTGGATTCTTGTTTCTTGATCAGTTATATGC
                      ____________________________________________________________
consensus CAC---------------TCAAATTAAAGTTGGATTCTTGTTTCTTGATCAGTTATATGC
 
. : . : . : . : . : . :
JMFF002J10+ TTTTGTAGAGGTTTAAGATTTTCATTGTAAAGCTTACAGACT
JMFS078C04+ TTTTGTAGAGGTTTAAGATTTTCATTGTAAAGCTTACAGACTAAGGAAAATC
JMFF037A21+ TTTTGTAGAGGTTTAAGATTTTCATTGTAAAGCTTACAGACTAAGGAAAATCCTGATTCC
JMSF022H20+ TTTTGTAGAGGTTTAAGATTTTCATTGTAAAGCTTACAGACTAAGGAAAATCCTGATTCC
JMSF049B02+ TTTTGTAGAGGTTTAAGATTTTCATTGTAAAGCTTACAGACTAAGGAAAATCCTGATTCC
                      ____________________________________________________________
consensus TTTTGTAGAGGTTTAAGATTTTCATTGTAAAGCTTACAGACTAAGGAAAATCCTGATTCC
 
. : . : . : . : . : . :
JMFF037A21+ AAGCTTTTCTTGTACACTTATAAGCTACTCCGTACTATATTAGTC
JMSF022H20+ AAGCTTTTCTTGTACACTTATAAGCTACTCCGTACTATATTAGTC
JMSF049B02+ AAGCTTTTCTTGTACACTTATAAGCTACTCCGTACTATATTAGTCAGCTGTACAAATTTC
                      ____________________________________________________________
consensus AAGCTTTTCTTGTACACTTATAAGCTACTCCGTACTATATTAGTCAGCTGTACAAATTTC