Previous Contig 007879:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN037J17Sequence422007879 (5)gb:AY007225_15578624e-26Lycopersicon esculentum transaldolase ToTAL2 mRNA, complete cds.
JMSF022N19Sequence695007879 (5)gb:AY007225_15578623e-89Lycopersicon esculentum transaldolase ToTAL2 mRNA, complete cds.757007879 (5)gb:AY007225_15578623e-83Lycopersicon esculentum transaldolase ToTAL2 mRNA, complete cds.
JMSF048O24Sequence703007879 (5)gb:AY007225_15578625e-90Lycopersicon esculentum transaldolase ToTAL2 mRNA, complete cds.697007879 (5)gb:AY007225_15578628e-74Lycopersicon esculentum transaldolase ToTAL2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037J17+ GTATTCGGCATTCACGGCAAAAGCAGCACAGCAGCAAAATGT
rJMSF022N19- GCACAGCAACAAAATGT
                      ____________________________________________________________
consensus GTATTCGGCATTCACGGCAAAAGCAGCACAGCAGCAAAATGT
 
. : . : . : . : . : . :
JMFN037J17+ GATCAATAACAATATAACATGGTCTCCCAATGTCAAATAAAGACAATTGAAAGCTAGTCT
rJMSF048O24- AATAAAGACAATTGAAAGCTAGTCT
rJMSF022N19- GATCAATAACAATATAACATGGTCTCCCAATGTCAAATAAAGACAATTGAAAGCTAGTCT
                      ____________________________________________________________
consensus GATCAATAACAATATAACATGGTCTCCCAATGTCAAATAAAGACAATTGAAAGCTAGTCT
 
. : . : . : . : . : . :
JMFN037J17+ CTGTCTCTCCCATTTTTTGTTGATCTGATCATTTTATAAAAGAAACTAGAGATGAGGAGC
rJMSF048O24- CTGTCTCTCCCATTTTTTGTTGATCTGATCATTTTATAAAAGAAACTAGAGATGAGGAGC
rJMSF022N19- CTGTCTCTCCCATTTTTTGTTGATCTGATCATTTTATAAAAGAAACTAGAGATGAGGAGC
                      ____________________________________________________________
consensus CTGTCTCTCCCATTTTTTGTTGATCTGATCATTTTATAAAAGAAACTAGAGATGAGGAGC
 
. : . : . : . : . : . :
JMFN037J17+ ATTATTTTTTGACAACTGGGACTACGCATCATACATTTGGTGGTGGCCATATCTTCCCAA
rJMSF048O24- ATTATTTTTTGACAACTGGAACTACGCATCATACATTTGGTGGTGGCCATATCTTCCCAA
rJMSF022N19- ATTATTTTTTGACAACTGGAACTACGCATCATACATTTGGTGGTGGCCATATCTTCCCAA
                      ____________________________________________________________
consensus ATTATTTTTTGACAACTGGAACTACGCATCATACATTTGGTGGTGGCCATATCTTCCCAA
 
. : . : . : . : . : . :
JMFN037J17+ ACAACTCTTCCACCCGCTTTGCCTGATTGCTATACCCTTCCATTCCAGCAGTCAGAAGCT
rJMSF048O24- ACAACTCTTCCACCCGCTTTGCCTGATTGCTATACCCTTCCATTCCAGCAGTCAGAAGCT
rJMSF022N19- ACAACTCTTCCACCCGCTTTGCCTGATTGCTATACCCTTCCATTCCAGCAGTCAGAAGCT
                      ____________________________________________________________
consensus ACAACTCTTCCACCCGCTTTGCCTGATTGCTATACCCTTCCATTCCAGCAGTCAGAAGCT
 
. : . : . : . : . : . :
JMFN037J17+ CCACAGCAGCCGGTCCCATAGCTGAGGCGAAGCTATATTGATCCCACGTCACAACCTCCT
rJMSF048O24- CCACAGCAGCCGGTCCCATAGCTGAGGCGAAGCTATATTGATCCCACGTCACAACCTCCT
rJMSF022N19- CCACAGCAGCCGGTCCCATAGCTGAGGCGAAGCTATATTGATCCCACGTCACAACCTCCT
                      ____________________________________________________________
consensus CCACAGCAGCCGGTCCCATAGCTGAGGCGAAGCTATATTGATCCCACGTCACAACCTCCT
 
. : . : . : . : . : . :
JMFN037J17+ CTTTGGTAAAGTTATAGGCAGCAGCTGATTGTGGGGACAGCCTTCTTTCAAAAGAGTACT
rJMSF048O24- CTTTGGTAAAGTTATAGGCAGCAGCTGATTGTGGGGACAGCCTTCTTTCAAAAGAGTACT
rJMSF022N19- CTTTGGTAAAGTTATAGGCAGCAGCTGATTGTGGGGACAGCCTTCTTTCAAAAGAGTACT
                      ____________________________________________________________
consensus CTTTGGTAAAGTTATAGGCAGCAGCTGATTGTGGGGACAGCCTTCTTTCAAAAGAGTACT
 
. : . : . : . : . : . :
JMFN037J17+ TCTCATCTGGGGGAGTTACA
rJMSF048O24- TCTCATCTGGGGGAGTTACAGATTCTTTAAGAGACTGCAATATCTTTAGTGGGGTAACAA
rJMSF022N19- TCTCATCTGGGGGAGTTACAGATTCTTTAAGAGACTGCAATATCTTTAGTGGGGTAACAA
                      ____________________________________________________________
consensus TCTCATCTGGGGGAGTTACAGATTCTTTAAGAGACTGCAATATCTTTAGTGGGGTAACAA
 
. : . : . : . : . : . :
rJMSF048O24- TGTAATCAACCCCCAGAATGCTATAGACATCCTGCTTGTTCCGAATAGCCGCTGCCATCA
rJMSF022N19- TGTAATCAACCCCCAGAATGCTATAGACATCCTGCTTGTTCCGAATAGCCGCTGCCATCA
                      ____________________________________________________________
consensus TGTAATCAACCCCCAGAATGCTATAGACATCCTGCTTGTTCCGAATAGCCGCTGCCATCA
 
. : . : . : . : . : . :
rJMSF048O24- ACTTCGATTTATGCCCATATTTGTGGATGTAGTTATAAGCTTTTGTCACCAGAGCAGATC
rJMSF022N19- ACTTCGATTTATGCCCATATTTGTGGATGTAGTTATAAGCTTTTGTCACCAGAGCAGATC
                      ____________________________________________________________
consensus ACTTCGATTTATGCCCATATTTGTGGATGTAGTTATAAGCTTTTGTCACCAGAGCAGATC
 
. : . : . : . : . : . :
rJMSF048O24- CAGGATCTTCTCCTCTTCGAAGTGCACCTTCTACTTCAGAGTCACCAGAATGGTTCCGTG
rJMSF022N19- CAGGATCTTCTCCTCTTCGAAGTGCACCTTCTACTTCAGAGTCACCAGAATGGTTCCGTG
                      ____________________________________________________________
consensus CAGGATCTTCTCCTCTTCGAAGTGCACCTTCTACTTCAGAGTCACCAGAATGGTTCCGTG
 
. : . : . : . : . : . :
rJMSF048O24- CCCAATCCCTCAGCCGACCAACAAAAATCTGAATGACAGAAGCACCAGCTTGAGCAGCTG
rJMSF022N19- CCCAATCCCTCAGCCGACCAACAAAAATCTGAATGACAGAAGCACCAGCTTGAGCAGCTG
                      ____________________________________________________________
consensus CCCAATCCCTCAGCCGACCAACAAAAATCTGAATGACAGAAGCACCAGCTTGAGCAGCTG
 
. : . : . : . : . : . :
rJMSF048O24- CTGCAGCCTGAC-AAAACTGTAAACGAAAGTC-AATGGGTCTGTATGCCCTCAGCTTCCA
rJMSF022N19- CTGCAGCCTGACAAAAACTGTAAACGAAAGTCAAATGGGTCTGTATGCCCTCAGCTTCCA
JMSF022N19+ AACGAAAGTCAAATGGGTCTGTATGCCNTCAGCTTCCA
JMSF048O24+ AACGAAAGTCAAATGGGTCTGTATGCCNTCAGCTTCCA
                      ____________________________________________________________
consensus CTGCAGCCTGACAAAAACTGTAAACGAAAGTCAAATGGGTCTGTATGCCCTCAGCTTCCA
 
. : . : . : . : . : . :
rJMSF048O24- GCAACCTTGATGCC
rJMSF022N19- GCAACCTTGATGCC
JMSF022N19+ GCAACCTTGATGCCTCAATCCCTTGCCAAGTTGCAGGGATTTTGAACAGCAACCTCTCTG
JMSF048O24+ GCAACCTTGATGCCTCAATCCCTTGCCAAGTTGCAGGGATTTTGAACAGCAACCTCTCTG
                      ____________________________________________________________
consensus GCAACCTTGATGCCTCAATCCCTTGCCAAGTTGCAGGGATTTTGAACAGCAACCTCTCTG
 
. : . : . : . : . : . :
JMSF022N19+ GAGGAATTTCAATCCCATTGTACAACTTCAAGAGGTCATGCACCTTTAGAACAATGCCAT
JMSF048O24+ GAGGAATTTCAATCCCATTGTACAACTTCAAGAGGTCATGCACCTTTAGAACAATGCCAT
                      ____________________________________________________________
consensus GAGGAATTTCAATCCCATTGTACAACTTCAAGAGGTCATGCACCTTTAGAACAATGCCAT
 
. : . : . : . : . : . :
JMSF022N19+ GCGTGTCATATGCAAGACGAGCATCAACTTCAGTAGAAACACGACCAGGCACAAGTTTTG
JMSF048O24+ GCGTGTCATATGCAAGACGAGCATCAACTTCAGTAGAAACACGACCAGGCACAAGTTTTG
                      ____________________________________________________________
consensus GCGTGTCATATGCAAGACGAGCATCAACTTCAGTAGAAACACGACCAGGCACAAGTTTTG
 
. : . : . : . : . : . :
JMSF022N19+ CTAGATCACCACCAACATTGACCAATGCCTTGTTAAAGAAACAAGACATTCGTGCATCCT
JMSF048O24+ CTAGATCACCACCAACATTGACCAATGCCTTGTTAAAGAAACAAGACATTCGTGCATCCT
                      ____________________________________________________________
consensus CTAGATCACCACCAACATTGACCAATGCCTTGTTAAAGAAACAAGACATTCGTGCATCCT
 
. : . : . : . : . : . :
JMSF022N19+ TGTCCTCCAACCCATAACACTCCTGATCTGCTAAAGCAGTGTCCACAGCACTCTTGAATT
JMSF048O24+ TGTCCTCCAACCCATAACACTCCTGATCTGCTAAAGCAGTGTCCACAGCACTCTTGAATT
                      ____________________________________________________________
consensus TGTCCTCCAACCCATAACACTCCTGATCTGCTAAAGCAGTGTCCACAGCACTCTTGAATT
 
. : . : . : . : . : . :
JMSF022N19+ TGGTATCAGGAAGGCTGCAGATGCCTAAGAGTAGAGATGAGCTAACAGTAGCAGCAGTTG
JMSF048O24+ TGGTATCAGGAAGGCTGCAGATGCCTAAGAGTAGAGATGAGCTAACAGTAGCAGCAGTTG
                      ____________________________________________________________
consensus TGGTATCAGGAAGGCTGCAGATGCCTAAGAGTAGAGATGAGCTAACAGTAGCAGCAGTTG
 
. : . : . : . : . : . :
JMSF022N19+ GTGGGAACTTCTCGAAATCATCGAAAACTACAGTATCTGGAACGATCTCACTGTAATTCG
JMSF048O24+ GTGGGAACTTCTCGAAATCATCGAAAACTACAGTATCTGGAACGATCTCACTGTAATTCG
                      ____________________________________________________________
consensus GTGGGAACTTCTCGAAATCATCGAAAACTACAGTATCTGGAACGATCTCACTGTAATTCG
 
. : . : . : . : . : . :
JMSF022N19+ TGACCGCATCCAATTCAGTAGTCAAACCTGTGTCCAGTGAAGAAGAGAATCCAGCAGAAG
JMSF048O24+ TGACCGCATCCAATTCAGTAGTCAAACCTGTGTCCAGTGAAGAAGAGAATCCAGCAGAAG
                      ____________________________________________________________
consensus TGACCGCATCCAATTCAGTAGTCAAACCTGTGTCCAGTGAAGAAGAGAATCCAGCAGAAG
 
. : . : . : . : . : . :
JMSF022N19+ CTCGGATGACAGGAAAGCATGGCTTCGAATTGAAGGAGAGACTCGGTTTCGTAGACTGAG
JMSF048O24+ CTCGGATGACAGGAAAGCATGGCTTCGAATTGAAGGAGAGACTCGGTTTCGTAGACTGAG
                      ____________________________________________________________
consensus CTCGGATGACAGGAAAGCATGGCTTCGAATTGAAGGAGAGACTCGGTTTCGTAGACTGAG
 
. : . : . : . : . : . :
JMSF022N19+ CTGCGAATTTCAGTTTCCTCTCCTGAGAAGCTGAAGAGGAGCGGGAGGAGGAGAAAGCAT
JMSF048O24+ CTGCGAATTTCAGTTTCCTCTCCTGAGAAGCTGAAGAGGAGCGGGAGGAGGAGAAAGCAT
                      ____________________________________________________________
consensus CTGCGAATTTCAGTTTCCTCTCCTGAGAAGCTGAAGAGGAGCGGGAGGAGGAGAAAGCAT
 
. : . : . : . : . : . :
JMSF022N19+ AGGAGAGTGGAGAGTGCAATGTAGTCGACATTTTCAATGCGGATATTGAGTGAACT
JMSF048O24+ AGGAGAGTGGAGAGTGCAATGTAGTCGACATTTTCAATGCGGATATTGAGTGAACTAGCC
                      ____________________________________________________________
consensus AGGAGAGTGGAGAGTGCAATGTAGTCGACATTTTCAATGCGGATATTGAGTGAACTAGCC