Previous Contig 007878:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS031G04Sequence497007878 (3)gb:AF396830_17957684e-56Prunus persica ethylene receptor (ETR) gene, complete cds.
JMFS103D08Sequence558007878 (3)gb:AF396830_17957683e-65Prunus persica ethylene receptor (ETR) gene, complete cds.
JMSF048O20Sequence688007878 (3)gb:AF386525_17947212e-87Pyrus communis putative ethylene receptor (DETR1a) gene, complete cds.716024334sp|O48929|ETR1_TOBAC3e-67Ethylene receptor (EC 2.7.3.-) (NT-ETR1).>pir|T01897|T01897 ethylene-response pr

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048O20+ CTCCACAAGTGTAGTCTTTAAAATAGTA
                      ____________________________________________________________
consensus CTCCACAAGTGTAGTCTTTAAAATAGTA
 
. : . : . : . : . : . :
JMSF048O20+ TGCCTATCAAGAGTGCTTCTAATTTCATGAGTAAGCATTCTAACATGTCTACCTGTCTCT
                      ____________________________________________________________
consensus TGCCTATCAAGAGTGCTTCTAATTTCATGAGTAAGCATTCTAACATGTCTACCTGTCTCT
 
. : . : . : . : . : . :
JMFS103D08+ CAAGTTCTGCAGCCTTGTTTTTTAAGAAC
JMSF048O20+ TCTTGTGTGCGGATAAGGCCCATTTCTCGATCAAGTTCTGCAGCCTTGTTTTTTAAGAAC
                      ____________________________________________________________
consensus TCTTGTGTGCGGATAAGGCCCATTTCTCGATCAAGTTCTGCAGCCTTGTTTTTTAAGAAC
 
. : . : . : . : . : . :
JMFS031G04+ AATAAATCAGGTATAATGTGCACTAGCATGAGCGCAGTC
JMFS103D08+ AGTTCCCTAGTTTTGACACTTAATAAATCAGGTATAATGTGCACTAGCATGAGCGCAGTC
JMSF048O20+ AGTTCCCTAGTTTTGACACTTAATAAATCAGGTATAATGTGCACTAGCATGAGCGCAGTC
                      ____________________________________________________________
consensus AGTTCCCTAGTTTTGACACTTAATAAATCAGGTATAATGTGCACTAGCATGAGCGCAGTC
 
. : . : . : . : . : . :
JMFS031G04+ ACACATGAAACTAATGCAGTCAATAGCTTTGCGGTTGTCATGACTATAGCTACTGTTCTT
JMFS103D08+ ACACATGAAACTAATGCAGTCAATAGCTTTGCGGTTGTCATGACTATAGCTACTGTTCTT
JMSF048O20+ ACACATGAAACTAATGCAGTCAATAGCTTTGCGGTTGTCATGACTATAGCTACTGTTCTT
                      ____________________________________________________________
consensus ACACATGAAACTAATGCAGTCAATAGCTTTGCGGTTGTCATGACTATAGCTACTGTTCTT
 
. : . : . : . : . : . :
JMFS031G04+ GTATGCATGCCAAATGTCCATAAGTTTATAAAGTGTGTAGCTCCACAAAGAATAATAAAT
JMFS103D08+ GTATGCATGCCAAATGTCCATAAGTTTATAAAGTGTGTAGCTCCACAAAGAATAATAAAT
JMSF048O20+ GTATGCATGCCAAATGTCCATAAGTTTATAAAGTGTGTAGCTCCACAAAGAATAATAAAT
                      ____________________________________________________________
consensus GTATGCATGCCAAATGTCCATAAGTTTATAAAGTGTGTAGCTCCACAAAGAATAATAAAT
 
. : . : . : . : . : . :
JMFS031G04+ GCACCGAACTGCACAAGCACCCATCTATAAGGAAAAACTGCAGATTTCTTAACAAAGTAT
JMFS103D08+ GCACCGAACTGCACAAGCACCCATCTATAAGGAAAAACTGCAGATTTCTTAACAAAGTAT
JMSF048O20+ GCACCGAACTGCACAAGCACCCATATATAAGGAAAAACTGCAGATTTCTTAACAAAGTAT
                      ____________________________________________________________
consensus GCACCGAACTGCACAAGCACCCATCTATAAGGAAAAACTGCAGATTTCTTAACAAAGTAT
 
. : . : . : . : . : . :
JMFS031G04+ ATCAACTCAACTGGGATGGAAAAATAAGCAAGTGCGATGAAGAAATCTGATATATACTGA
JMFS103D08+ ATCAACTCAACTGGGATGGAAAAATAAGCAAGTGCGATGAAGAAATCTGATATATACTGA
JMSF048O20+ ATCAACTCAACTGGGATGGAAAAATAAGCAAGTGCGATGAAGAAATCTGATATATACTGA
                      ____________________________________________________________
consensus ATCAACTCAACTGGGATGGAAAAATAAGCAAGTGCGATGAAGAAATCTGATATATACTGA
 
. : . : . : . : . : . :
JMFS031G04+ TACTTCATCAGTAACTCGTCGGCAGGCCATTGCGGGTCAATGCAATTACAAGACTCCATT
JMFS103D08+ TACTTCATCAGTAACTCGTCGGCAGGCCATTGCGGGTCAATGCAATTACAAGACTCCATT
JMSF048O20+ TACTTCATCAGTAACTCGTCGGCAGGCCATTGCGGGTCAATGCAATTACAAGACTCCATT
                      ____________________________________________________________
consensus TACTTCATCAGTAACTCGTCGGCAGGCCATTGCGGGTCAATGCAATTACAAGACTCCATT
 
. : . : . : . : . : . :
JMFS031G04+ ATAAACTTTCAATCTCAGCTGCAACACTTTCTTATGAACACACCATACTTCTCTGAGGAT
JMFS103D08+ ATAAACTTTCAATCTCAGCTGCAACACTTTCTTATGAACACACCATACTTCTCTGAGGAT
JMSF048O20+ ATAAACTTTCAATCTCAGCTGCAACACTTTCTTATGAACACACCATACTTCTCTGAGGAT
                      ____________________________________________________________
consensus ATAAACTTTCAATCTCAGCTGCAACACTTTCTTATGAACACACCATACTTCTCTGAGGAT
 
. : . : . : . : . : . :
JMFS031G04+ CCGTCAAAAGCTTTCAACTTTAGCAGAAGCAGTTTCCATTGCCTTGACTTTGTGAGGAAT
JMFS103D08+ CCGTCAAAAGCTTTCAACTTTAGCAGAAGCAGTTTCCATTGCCTTGACTTTGTGAGGAAT
JMSF048O20+ CCGTCAAAAGCTTTCAACTTTAGCAGAAGCAGTTTCCATTGCCTTGACTTTGTGAGGAAT
                      ____________________________________________________________
consensus CCGTCAAAAGCTTTCAACTTTAGCAGAAGCAGTTTCCATTGCCTTGACTTTGTGAGGAAT
 
. : . : . : . : . : . :
JMFS031G04+ TTGGAGCTCAACAACACAGCTTTTTTTTACTCGGTTCA
JMFS103D08+ TTGGAGCTCAACAACACAGCTTTTTTTTACTCGGTTCAGGCAAGCTTTA
JMSF048O20+ TTGGAGCTCAACAACACAGCTTTTTTTTACTCGGTTCAGGCAAGCTTTAGACAAAACAGC
                      ____________________________________________________________
consensus TTGGAGCTCAACAACACAGCTTTTTTTTACTCGGTTCAGGCAAGCTTTAGACAAAACAGC