Previous Contig 007868:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN033D17Sequence609007868 (2)gb:NTOEE2AG_16916568e-14N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.
JMSF048N04Sequence619007868 (2)gb:NTOEE2AG_16916568e-14N.tabacum gene for photosystem II oxygen evolving complex 23 kDa polypeptide.788001436 (120)sp|P93566|PSBP_SOLTU3e-83Oxygen-evolving enhancer protein 2, chloroplast precursor (OEE2) (23 kDa subunit

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN033D17+ GTGTTTGTTTTCGGCTTTCCGAAAACATTCGCTGCA
JMSF048N04+ TCCGAAAACATTCGCTGCA
                      ____________________________________________________________
consensus GTGTTTGTTTTCGGCTTTCCGAAAACATTCGCTGCA
 
. : . : . : . : . : . :
JMFN033D17+ ATCCACCATCAACATTAGCATCCAAAGACTCTAAGGATACCGGTGGTAGGCTCTCGATGG
JMSF048N04+ ATCCACCATCAACATTAGCATCCAAAGACTCTAAGGATACCGGTGGTAGGCTCTCGATGG
                      ____________________________________________________________
consensus ATCCACCATCAACATTAGCATCCAAAGACTCTAAGGATACCGGTGGTAGGCTCTCGATGG
 
. : . : . : . : . : . :
JMFN033D17+ ATCGACGATCCATCCTCACATACTCAATCAAGCTTAAACTAAGAGATAATTGACACTAAA
JMSF048N04+ ATCGACGATCCATCCTCACATACTCAATCAAGCTTAAACTAAGAGATAATTGACACTAAA
                      ____________________________________________________________
consensus ATCGACGATCCATCCTCACATACTCAATCAAGCTTAAACTAAGAGATAATTGACACTAAA
 
. : . : . : . : . : . :
JMFN033D17+ TAATCTGATTGTTATGTGTCTAGCAAATACGATTAACGATTCCGGCACACATTTTAACTC
JMSF048N04+ TAATCTGATTGTTATGTGTCTAGCAAATACGATTAACGATTCCGGCACACATTTTAACTC
                      ____________________________________________________________
consensus TAATCTGATTGTTATGTGTCTAGCAAATACGATTAACGATTCCGGCACACATTTTAACTC
 
. : . : . : . : . : . :
JMFN033D17+ GTTCAATCCAATCATAACTACAATCAAAATCATTACCAGAAACAGTACAGTGACTGAAAA
JMSF048N04+ GTTCAATCCAATCATAACTACAATCAAAATCATTACCAGAAACAGTACAGTGACTGAAAA
                      ____________________________________________________________
consensus GTTCAATCCAATCATAACTACAATCAAAATCATTACCAGAAACAGTACAGTGACTGAAAA
 
. : . : . : . : . : . :
JMFN033D17+ GGAGATAAACAATTAACGAATGAGGAGAAGCATGTACCGGCTTCACCGTAGGCGGCGTCG
JMSF048N04+ GGAGATAAACAATTAACGAATGAGGAGAAGCATGTACCGGCTTCACCGTAGGCGGCGTCG
                      ____________________________________________________________
consensus GGAGATAAACAATTAACGAATGAGGAGAAGCATGTACCGGCTTCACCGTAGGCGGCGTCG
 
. : . : . : . : . : . :
JMFN033D17+ GCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGAGCCAATCGG
JMSF048N04+ GCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGAGCCAATCGG
                      ____________________________________________________________
consensus GCAGGGGAAACCTTAGAGCCAACAGCGGCAGCGCCGATGAGGACGGTGAGAGCCAATCGG
 
. : . : . : . : . : . :
JMFN033D17+ CGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGACTGCTTCTGA
JMSF048N04+ CGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGACTGCTTCTGA
                      ____________________________________________________________
consensus CGAGAGACGGCGACCGAAGAGGCGGCGTCGTCTTCATGAGCCGAGGCGGACTGCTTCTGA
 
. : . : . : . : . : . :
JMFN033D17+ GCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAGGAAGATGGC
JMSF048N04+ GCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAGGAAGATGGC
                      ____________________________________________________________
consensus GCGCGGCAGACAAGCTGGTTAGGCTTCAGTACCGGAACGTAACGGTTCGAGGAAGATGGC
 
. : . : . : . : . : . :
JMFN033D17+ CTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAAGCCATGATC
JMSF048N04+ CTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAAGCCATGATC
                      ____________________________________________________________
consensus CTAGCAGGGGCAGAGAGTGCAGGGTGGTGCAAGTAGAAGCACTGTGTGGAAGCCATGATC
 
. : . : . : . : . : . :
JMFN033D17+ GCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTG
JMSF048N04+ GCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAGCTTAGCTTC
                      ____________________________________________________________
consensus GCGCGCGGAGGAGCTTACTGTCTTGTCTGTCTGTCTGTCTCGCCGCTTTAGCTTAGCTTC