Previous Contig 007862:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF016J21Sequence240007862 (3)gb:GMJ004899_16804975e-15Glycine max mRNA for rudimentary enhancer, partial.733007862 (3)gb:GMJ004899_16804971e-43Glycine max mRNA for rudimentary enhancer, partial.
JMSF048L24Sequence670007862 (3)gb:GMJ004899_16804977e-46Glycine max mRNA for rudimentary enhancer, partial.698008931 (4)gb:AY123847_15800565e-84Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016J21- AAGTTGGGCATTCATTATAC
                      ____________________________________________________________
consensus AAGTTGGGCATTCATTATAC
 
. : . : . : . : . : . :
rJMSF016J21- AAGCCAACACAAGCCTAAGATCCAGTGGTTGGACGAGATACAAACTAATAGGGAAAGTAA
JMSF048L24+ GGGAAAGTAA
                      ____________________________________________________________
consensus AAGCCAACACAAGCCTAAGATCCAGTGGTTGGACGAGATACAAACTAATAGGGAAAGTAA
 
. : . : . : . : . : . :
rJMSF016J21- CAGTCAACTTCCATCTGATGCTGCAAATAGTAGGCTATGTGCATTAAGATTTAAGAAAGA
JMSF048L24+ CAGTCAACTTCCATCTGATGCTGCAAATAGTAGGCTATGTGCATTAAGATTTAAGAAAGA
                      ____________________________________________________________
consensus CAGTCAACTTCCATCTGATGCTGCAAATAGTAGGCTATGTGCATTAAGATTTAAGAAAGA
 
. : . : . : . : . : . :
rJMSF016J21- AACTACAGTAATTGATGCATGATAAGAAGAAACTACAGTAATTGATGCATGATAAGAGTA
JMSF048L24+ AACTACAGTAATTGATGCATGATAAGAAGAAACTACAGTAATTGATGCATGATAAGAGTA
                      ____________________________________________________________
consensus AACTACAGTAATTGATGCATGATAAGAAGAAACTACAGTAATTGATGCATGATAAGAGTA
 
. : . : . : . : . : . :
rJMSF016J21- TTTTGATCAAAGATCTGCACAGCTGTTAACAGCATTCACTATACCAATTTCTCTTCATAG
JMSF048L24+ TTTTGATCAAAGATCTGCACAGCTGTTAACAGCATTCACTATACCAATTTCTCTTCATAG
                      ____________________________________________________________
consensus TTTTGATCAAAGATCTGCACAGCTGTTAACAGCATTCACTATACCAATTTCTCTTCATAG
 
. : . : . : . : . : . :
rJMSF016J21- TAGCCAATATGATTGCATATGGAGGATGGAGACTATCATTTCATATACCATATCAGTTTG
JMSF048L24+ TAGCCAATATGATTGCATATGGAGGATGGAGACTATCATTTCATATACCATATCAGTTTG
                      ____________________________________________________________
consensus TAGCCAATATGATTGCATATGGAGGATGGAGACTATCATTTCATATACCATATCAGTTTG
 
. : . : . : . : . : . :
rJMSF016J21- AGGCCAA-TTTTTCAAATGTTGCAACGTCTTCTGTTTTATCCACTGCCGATCGTAAGGCA
JMSF048L24+ AGGCCAATTTTTTCAAATGTTGCAACGTCTTCTGTTTTATCCACTGCCGATCGTAAGGCA
                      ____________________________________________________________
consensus AGGCCAATTTTTTCAAATGTTGCAACGTCTTCTGTTTTATCCACTGCCGATCGTAAGGCA
 
. : . : . : . : . : . :
rJMSF016J21- AGTACGCCTGAATTGAGTGATCATAGACTAGTGCACTCATGTCTGCAAGTCCATCAATAA
JMSF048L24+ AGTACGCCTGAATTGAGTGATCATAGACTAGTGCACTCATGTCTGCAAGTCCATCAATAA
                      ____________________________________________________________
consensus AGTACGCCTGAATTGAGTGATCATAGACTAGTGCACTCATGTCTGCAAGTCCATCAATAA
 
. : . : . : . : . : . :
rJMSF016J21- AATTGTAAAGATCAGAGATATCATAAGAGATGTTTCTTATAGCTGGGTTTAACTCCTTCA
JMSF016J21+ CCTTCA
JMSF048L24+ AATTGTAAAGATCAGAGATATCATAAGAGATGTTTCTTATAGCTGGGTTTAACTCCTTCA
                      ____________________________________________________________
consensus AATTGTAAAGATCAGAGATATCATAAGAGATGTTTCTTATAGCTGGGTTTAACTCCTTCA
 
. : . : . : . : . : . :
rJMSF016J21- GCTTTCTTTCATATAGAGCACAAATTCCATCCATTGATTGAGTGATGGAATGATAATCCA
JMSF016J21+ GCTTTCTTTCATATAGAGCACAAATTCCATCCATTGATTGAGTGATGGAATGATAATCCA
JMSF048L24+ GCTTTCTTTCATATAGAGCACAAATTCCATCCATTGCTTGAGTGATGGAATCATAATCCA
                      ____________________________________________________________
consensus GCTTTCTTTCATATAGAGCACAAATTCCATCCATTGATTGAGTGATGGAATGATAATCCA
 
. : . : . : . : . : . :
rJMSF016J21- TAAAAGTGCGAGTTCCTCTATGCTGAGATGTTTGCATGAGAATAATAGTGTGTTTATTTG
JMSF016J21+ TAAAAGTGCGAGTTCCTCTATGCTGAGATGTTTGCATGAGAATAATAGTGTGTTTATTTG
JMSF048L24+ TAAAAGTGCGAGTTCCTCTATGCTGAGATGTTTGCATGAGAATAATAGTGTGTTTATTTG
                      ____________________________________________________________
consensus TAAAAGTGCGAGTTCCTCTATGCTGAGATGTTTGCATGAGAATAATAGTGTGTTTATTTG
 
. : . : . : . : . : . :
rJMSF016J21- CCATTGGTTACGATGGAAGATCAAAGCCAAGTTTATGAAGCCTTTGGCGACGTTTTCAGG
JMSF016J21+ CCATTGGTTACGATGGAAGATCAAAGCCAAGTTTATGAAGCCTTTGGCGACGTTTTCAGG
JMSF048L24+ CCATTGGTTACGATGGAAGATCAAAGCCAAGTTTATGAAGCCTTTGGCGACGTTTTCAGG
                      ____________________________________________________________
consensus CCATTGGTTACGATGGAAGATCAAAGCCAAGTTTATGAAGCCTTTGGCGACGTTTTCAGG
 
. : . : . : . : . : . :
rJMSF016J21- AGAGTGTTAAGTAGAAATGGGAGGAGTTTGGAAATTTGGGCAGATGTTTATCC
JMSF016J21+ AGAGTGTTAAGTAGAAATGGGAGGAGTTTGGAAATTTGGGCAGATGTTTATCC
JMSF048L24+ AGAGTGTTAAGTAGAAATGGGAGGAGTTTGGAAATTTGGGCAGATGTTTATCCAAGTCTC
                      ____________________________________________________________
consensus AGAGTGTTAAGTAGAAATGGGAGGAGTTTGGAAATTTGGGCAGATGTTTATCCAAGTCTC