Previous Contig 007860:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007I08Sequence420007860 (2)gb:AY091138_15743593e-12Arabidopsis thaliana unknown protein (At2g37840) mRNA, complete cds.129020796
JMSF048L16Sequence713007860 (2)gb:AY091138_15743593e-41Arabidopsis thaliana unknown protein (At2g37840) mRNA, complete cds.837024323gb:AY091138_15743595e-51Arabidopsis thaliana unknown protein (At2g37840) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048L16+ ACTTTTAAGCCTGATGCTAGCTGCTGCATAAAATGCTTTGCAGTAGTTTCTGG
                      ____________________________________________________________
consensus ACTTTTAAGCCTGATGCTAGCTGCTGCATAAAATGCTTTGCAGTAGTTTCTGG
 
. : . : . : . : . : . :
JMSF048L16+ GATTCTACCATGGCGTTTTTGAAGGTACATAGAAAGATCACNTCCTCTACGATACTCCAG
                      ____________________________________________________________
consensus GATTCTACCATGGCGTTTTTGAAGGTACATAGAAAGATCACNTCCTCTACGATACTCCAG
 
. : . : . : . : . : . :
JMSF048L16+ AACTATATAAATTTTTCCAGGTTCCTCGATCATATCGTGCAAGCGGATAATGTTACAATG
                      ____________________________________________________________
consensus AACTATATAAATTTTTCCAGGTTCCTCGATCATATCGTGCAAGCGGATAATGTTACAATG
 
. : . : . : . : . : . :
JMFF007I08+ CTCTCCTGCAGTTTAGAGTTGAG
JMSF048L16+ ATTGATCTTCTTAAGAATCACAATCTCGGACTTGAGGCTCTCCTGCAGTTTAGAGTTGAG
                      ____________________________________________________________
consensus ATTGATCTTCTTAAGAATCACAATCTCGGACTTGAGGCTCTCCTGCAGTTTAGAGTTGAG
 
. : . : . : . : . : . :
JMFF007I08+ GCGAGCGGTAGCTATCTCCTTGATGGCCACTTCGGTGCCGTCAACGCGGTGGCGGGCATG
JMSF048L16+ GCGAGCGGTAGCTATCTCCTTGATGGCCACTTCGGTGCCGTCAACGCGGTGGCGGGCATG
                      ____________________________________________________________
consensus GCGAGCGGTAGCTATCTCCTTGATGGCCACTTCGGTGCCGTCAACGCGGTGGCGGGCATG
 
. : . : . : . : . : . :
JMFF007I08+ CCNCACCGTGGAAAACGAACCCATCCCTATCTGCTTCGAGACCACATAGTCCCCCACCGC
JMSF048L16+ CCACACCGTGGAAAACGAACCCATCCCTATCTGCTTCGAGACCACATAGTCCCCCACCGC
                      ____________________________________________________________
consensus CCACACCGTGGAAAACGAACCCATCCCTATCTGCTTCGAGACCACATAGTCCCCCACCGC
 
. : . : . : . : . : . :
JMFF007I08+ GAACCTCCCACCACCTCTGCTGCTCATCATTGAGCCACCACCCACCGAACCCTAGCAATC
JMSF048L16+ GAACCTCCCACCACCTCTGCTGCTCATCATTGAGCCACCACCCACCGAACCCTAGCAATC
                      ____________________________________________________________
consensus GAACCTCCCACCACCTCTGCTGCTCATCATTGAGCCACCACCCACCGAACCCTAGCAATC
 
. : . : . : . : . : . :
JMFF007I08+ CCAACTGAACCAAAACACACCCTTTCCGTTCCCGAGCACAATATCAACTAATGCGAATAA
JMSF048L16+ CCAACTGAACCAAAACACACCCTTTCCGTTCCCGAGCACAATATCAACTAATGCGAATAA
                      ____________________________________________________________
consensus CCAACTGAACCAAAACACACCCTTTCCGTTCCCGAGCACAATATCAACTAATGCGAATAA
 
. : . : . : . : . : . :
JMFF007I08+ GCTCCTCCTTTTGTGGAGCGTCGAATTCTTTGTTTTGCTTTCATTGTATCGGAATTTCTC
JMSF048L16+ GCTCCTCCTTTTGTGGAGCGTCGAATTCTTTGTTTTGCTTTCATTGTATCGGAATTTCTC
                      ____________________________________________________________
consensus GCTCCTCCTTTTGTGGAGCGTCGAATTCTTTGTTTTGCTTTCATTGTATCGGAATTTCTC
 
. : . : . : . : . : . :
JMFF007I08+ GATGGGCTCTATGGATATGGAGATGAGATCAAGGTGGTGGGTTTAAGCTAGAGCTTGGAG
JMSF048L16+ GATGGGCTCTATGGATATGGAGATGAGATCAAGGTGGTGGGTTTAAGCTAGAGCTTGGAG
                      ____________________________________________________________
consensus GATGGGCTCTATGGATATGGAGATGAGATCAAGGTGGTGGGTTTAAGCTAGAGCTTGGAG
 
. : . : . : . : . : . :
JMFF007I08+ CTGTGATGGAGGTGTTTGAGAGTTTAAAATTTATAAT
JMSF048L16+ CTGTGATGGAGGTGTTTGAGAGTTTAAAATTTATAATAATAATAATTGAGATCAAAGGGT
                      ____________________________________________________________
consensus CTGTGATGGAGGTGTTTGAGAGTTTAAAATTTATAATAATAATAATTGAGATCAAAGGGT
 
. : . : . : . : . : . :
JMSF048L16+ GAATCCAAAGGCGTTTGATATATGGGCAGCAGAGATTTTGGCAGAATGCTTCATCCTATC
                      ____________________________________________________________
consensus GAATCCAAAGGCGTTTGATATATGGGCAGCAGAGATTTTGGCAGAATGCTTCATCCTATC