Previous Contig 007848:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF006M05Sequence392007848 (2)pir|T05559|T055595e-21hypothetical protein F22K18.50 - Arabidopsis thaliana>gb:ATCHRIV62_1546358 Arabi
JMSF048J06Sequence656007848 (2)pir|T05559|T055595e-42hypothetical protein F22K18.50 - Arabidopsis thaliana>gb:ATCHRIV62_1546358 Arabi748013782 (3)gb:AP004023_18365316e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048J06+ TTTTTGGCACGCCACGATAAGATCTGTATCTTTTGGGAATTGTTCCTGGACTTTTG
                      ____________________________________________________________
consensus TTTTTGGCACGCCACGATAAGATCTGTATCTTTTGGGAATTGTTCCTGGACTTTTG
 
. : . : . : . : . : . :
JMSF048J06+ ATAAGAATTGACTATTATAGGACAAGGTAGGCACACCACTCCACCAGCCTCCCATCATAA
                      ____________________________________________________________
consensus ATAAGAATTGACTATTATAGGACAAGGTAGGCACACCACTCCACCAGCCTCCCATCATAA
 
. : . : . : . : . : . :
JMSF048J06+ AATTTGTAACCTTCATGGAAAGTGTACCAGGATCTAATCTAGTATCAACCTCAAAAATTG
                      ____________________________________________________________
consensus AATTTGTAACCTTCATGGAAAGTGTACCAGGATCTAATCTAGTATCAACCTCAAAAATTG
 
. : . : . : . : . : . :
JMSF006M05+ CACCCGTGCC-TTTCACGTTCAATTGATGGGCGAACATCAA
JMSF048J06+ GAATCCAGGCTGAGCCTTTCACCCGTGCCTTTTCACGTTCAATTGATGGGCGAACATCAA
                      ____________________________________________________________
consensus GAATCCAGGCTGAGCCTTTCACCCGTGCCTTTTCACGTTCAATTGATGGGCGAACATCAA
 
. : . : . : . : . : . :
JMSF006M05+ GCAGAGTTTTGTTTGAGAGCTGAATTGCATAGCCAGCTTCCCTTGGAGTGAGCATCTTTA
JMSF048J06+ GCAGAGTTTTGTTTGAGAGCTGAATTGCATAGCCAGCTTCCCTTGGAGTGAGCATCTTTA
                      ____________________________________________________________
consensus GCAGAGTTTTGTTTGAGAGCTGAATTGCATAGCCAGCTTCCCTTGGAGTGAGCATCTTTA
 
. : . : . : . : . : . :
JMSF006M05+ CCTTCCCCTCCCTGATCAAAGCATCCCATCTCTTTCTGGCGGCAGCCATATCTTTCATTT
JMSF048J06+ CCTTCCCCTCCCTGATCAAAGCATCCCATCTCTTTCTGGCGGCAGCCATATCTTTCATTT
                      ____________________________________________________________
consensus CCTTCCCCTCCCTGATCAAAGCATCCCATCTCTTTCTGGCGGCAGCCATATCTTTCATTT
 
. : . : . : . : . : . :
JMSF006M05+ GCTTCAACTCATACTCTTCTTCCACTTGTTGCATTCTTATTCCACTTCTGCACTGAAACT
JMSF048J06+ GCTTCAACTCATACTCTTCTTCCACTTGTTGCATTCTTATTCCACTTCTGCACTGAAACT
                      ____________________________________________________________
consensus GCTTCAACTCATACTCTTCTTCCACTTGTTGCATTCTTATTCCACTTCTGCACTGAAACT
 
. : . : . : . : . : . :
JMSF006M05+ TGACGAGTGAAACTCCGGATTTGAGAGACAACGGTGCTAATGAAGGTGCGAGGCAACTGG
JMSF048J06+ TGACGAGTGAAACTCCGGATTTGAGAGACAACGGTGCTAATGAAGGTGCGAGGCAACTGG
                      ____________________________________________________________
consensus TGACGAGTGAAACTCCGGATTTGAGAGACAACGGTGCTAATGAAGGTGCGAGGCAACTGG
 
. : . : . : . : . : . :
JMSF006M05+ CGGAACCTAGAAGATTCCATCTTTGTTGTTGTCGAGGACTGGTCATGAGAACAGAAAGTG
JMSF048J06+ CGGAACCTAGAAGATTCCATCTTTGTTGTTGTCGAGGACTGGTCATGAGAACAGAAAGTG
                      ____________________________________________________________
consensus CGGAACCTAGAAGATTCCATCTTTGTTGTTGTCGAGGACTGGTCATGAGAACAGAAAGTG
 
. : . : . : . : . : . :
JMSF006M05+ GGGGGAGTCCATGGCCAAGGCCAAGAGCTTCCATTGTTACAGTTACACCT
JMSF048J06+ GGGGGAGTCCATGGCCAAGGCCAAGAGCTTCCATTGTTACAGTTACACCTGAGAACAGAA
                      ____________________________________________________________
consensus GGGGGAGTCCATGGCCAAGGCCAAGAGCTTCCATTGTTACAGTTACACCTGAGAACAGAA
 
. : . : . : . : . : . :
JMSF048J06+ AGGAGATTTGAATTTGCTTATCCTTTCCTAAAATCTTTTTATTGGTTAAATGATCAGACC
                      ____________________________________________________________
consensus AGGAGATTTGAATTTGCTTATCCTTTCCTAAAATCTTTTTATTGGTTAAATGATCAGACC