Previous Contig 007843:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002E02Sequence571007843 (30)gb:AB055076_15214161e-19Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFF019F09Sequence439007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 415007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFF019O11Sequence463007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 425007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFF027I18Sequence548007843 (30)gb:AB055076_15214161e-19Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 514007843 (30)gb:AB055076_15214168e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFF028A24Sequence464007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 426007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFF041E23Sequence539007843 (30)gb:AB055076_15214169e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 538007843 (30)gb:AB055076_15214169e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFF050H06Sequence451007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 470007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN015M21Sequence257007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN016O11Sequence524007843 (30)gb:AB055076_15214169e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN018B07Sequence497007843 (30)gb:AC109601_17387726e-20Oryza sativa chromosome 3 BAC OSJNBa0004G03 genomic sequence, complete sequence.
JMFN020E04Sequence498007843 (30)gb:AB055076_15214167e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN025L06Sequence526007843 (30)gb:AB055076_15214169e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN029N02Sequence399007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN030K05Sequence514007843 (30)gb:AB055076_15214168e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN038M02Sequence422007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFN046B15Sequence485007843 (30)gb:AB055076_15214167e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFS034F11Sequence526007843 (30)gb:AB055076_15214169e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMFS169E08Sequence502007843 (30)gb:AB055076_15214168e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMSF030E22Sequence461007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 421007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMSF048G16Sequence568007843 (30)gb:AB055076_15214161e-19Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 523007843 (30)gb:AB055076_15214168e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD
JMSF051A22Sequence461007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD 420007843 (30)gb:AB055076_15214166e-20Oryza sativa (japonica cultivar-group) mRNA for mitochondrial ATP synthase 6 KD

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025L06+ GT
JMFS034F11+ TGT
JMFF002E02+ CTGGAAATTGAGAATTGAAAAGTAGTGCAACATGT
JMFF027I18+ TGT
rJMFF041E23- GT
JMFF041E23+ GT
JMSF048G16+ TTGAAAAGTAGTGCAACATGT
                      ____________________________________________________________
consensus CTGGAAATTGAGAATTGAAAAGTAGTGCAACATGT
 
. : . : . : . : . : . :
JMFN025L06+ TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFN016O11+ AAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFN030K05+ AAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFS034F11+ TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFS169E08+ AAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFN020E04+ AAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFN018B07+ AAACAGGAATCAGTATTTTAAATATTTCCGTGTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFN046B15+ AAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFF002E02+ TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
rJMFF027I18- ATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFF027I18+ TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
rJMFF041E23- TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMFF041E23+ TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
rJMSF048G16- AATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
JMSF048G16+ TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
                      ____________________________________________________________
consensus TAAACAGGAATCAGTATTTTAAATATTTCCGTTTGAAAGAAGAAATCTGGTGAGCCAAAT
 
. : . : . : . : . : . :
JMFN025L06+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN016O11+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN030K05+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFS034F11+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFS169E08+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN020E04+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN018B07+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN046B15+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFF050H06+ GGAGAAAACACTCTTCTAATTAACAGTATCCAAA
rJMFF050H06- GGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN038M02+ GAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFN029N02+ AAA
JMFF002E02+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
rJMFF027I18- CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFF027I18+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
rJMFF041E23- CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFF041E23+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
rJMFF019O11- GTATCCAAA
JMFF019O11+ GGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMFF019F09+ TTAACAGTATCCAAA
rJMSF048G16- CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMSF051A22+ TTTTTTTTTTGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
rJMSF051A22- AA
rJMSF030E22- AA
JMSF030E22+ TTTTTTTTTTGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
rJMFF028A24- GTATCCAAA
JMFF028A24+ TTTTTTTTGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
JMSF048G16+ CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
                      ____________________________________________________________
consensus CAGAAGCTCATGACAGAACAGAAGGGGGAGAAAACACTCTTCTAATTAACAGTATCCAAA
 
. : . : . : . : . : . :
JMFN025L06+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN016O11+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN030K05+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFS034F11+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFS169E08+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN020E04+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN018B07+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN046B15+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF050H06+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMFF050H06- TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN038M02+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFN029N02+ TTTCTCAATAAGCCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF002E02+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMFF027I18- TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF027I18+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMFF041E23- TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF041E23+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMFF019O11- TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF019O11+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMFF019F09- ATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF019F09+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMSF048G16- TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMSF051A22+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMSF051A22- TTTCTCAATAGACCAACGGTAAAGTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMSF030E22- TTTCTCANTAGACCAACGTAAAGGTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMSF030E22+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
rJMFF028A24- TTTCTC-ATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMFF028A24+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
JMSF048G16+ TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
                      ____________________________________________________________
consensus TTTCTCAATAGACCAACGTAAA-GTTTGCTTCCACCAAAAGCTATGGGGATGCTTTATGA
 
. : . : . : . : . : . :
JMFN025L06+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN016O11+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN030K05+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFS034F11+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFS169E08+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN020E04+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN018B07+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN046B15+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF050H06+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMFF050H06- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN038M02+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFN029N02+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF002E02+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMFF027I18- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF027I18+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMFF041E23- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF041E23+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMFF019O11- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF019O11+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMFF019F09- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF019F09+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMSF048G16- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMSF051A22+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMSF051A22- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMSF030E22- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMSF030E22+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
rJMFF028A24- AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMFF028A24+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
JMSF048G16+ AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
                      ____________________________________________________________
consensus AATCAGTATTGTCTGATTCATTTAGAAACAAAAGAAAACACAAGAAATTAAAAAGAAAAG
 
. : . : . : . : . : . :
JMFN025L06+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN016O11+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN030K05+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFS034F11+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTAGTCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFS169E08+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN020E04+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN018B07+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN046B15+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF050H06+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMFF050H06- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN038M02+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN029N02+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFN015M21- GGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF002E02+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMFF027I18- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF027I18+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMFF041E23- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF041E23+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMFF019O11- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF019O11+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMFF019F09- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF019F09+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMSF048G16- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMSF051A22+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMSF051A22- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMSF030E22- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMSF030E22+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
rJMFF028A24- TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMFF028A24+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
JMSF048G16+ TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
                      ____________________________________________________________
consensus TGCAGCTGTCTCAGGTGCAAATGCCTCTTATCCAGCATGAGCTTTGAGCTTTAAAATTAC
 
. : . : . : . : . : . :
JMFN025L06+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN016O11+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN030K05+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFS034F11+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFS169E08+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN020E04+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN018B07+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN046B15+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF050H06+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMFF050H06- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN038M02+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN029N02+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFN015M21- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF002E02+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMFF027I18- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF027I18+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMFF041E23- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF041E23+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMFF019O11- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF019O11+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMFF019F09- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF019F09+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMSF048G16- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMSF051A22+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMSF051A22- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMSF030E22- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMSF030E22+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
rJMFF028A24- TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMFF028A24+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
JMSF048G16+ TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
                      ____________________________________________________________
consensus TTTTTGTGCCTCTGCGCGAATTTAGAGTTCTTAGCGTCCTCCTCAGTGAGGCCGAGGGAC
 
. : . : . : . : . : . :
JMFN025L06+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN016O11+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN030K05+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFS034F11+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFS169E08+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN020E04+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN018B07+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN046B15+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF050H06+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMFF050H06- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN038M02+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN029N02+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFN015M21- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF002E02+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMFF027I18- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF027I18+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMFF041E23- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF041E23+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMFF019O11- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF019O11+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMFF019F09- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF019F09+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMSF048G16- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMSF051A22+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMSF051A22- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMSF030E22- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMSF030E22+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
rJMFF028A24- ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMFF028A24+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
JMSF048G16+ ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
                      ____________________________________________________________
consensus ATCTTGGTGATGACGGCGCCGGTGATGGCGAAGCCGACTAGGAACGGCCAGTTCCGGCCC
 
. : . : . : . : . : . :
JMFN025L06+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN016O11+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN030K05+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFS034F11+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFS169E08+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN020E04+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN018B07+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN046B15+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF050H06+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMFF050H06- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN038M02+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN029N02+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFN015M21- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF002E02+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMFF027I18- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF027I18+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMFF041E23- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF041E23+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMFF019O11- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF019O11+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMFF019F09- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF019F09+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMSF048G16- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMSF051A22+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMSF051A22- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMSF030E22- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMSF030E22+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
rJMFF028A24- CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMFF028A24+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
JMSF048G16+ CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
                      ____________________________________________________________
consensus CACTCCCGGCGGAAAAACACTGGCCATGGATCGAACTGCCTCATTTTCCGGCTAGGCTTT
 
. : . : . : . : . : . :
JMFN025L06+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTA
JMFN016O11+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAG
JMFN030K05+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGC
JMFS034F11+ TGTACGGTCTCTCTCTAGAATTGGCTGT
JMFS169E08+ TGTACGGTCTCTCTCTAGAATTGG
JMFN020E04+ TGTACGGTCTCTCTCTAGAA
JMFN018B07+ TG-ACGGTCTCTCTCTAGAA
JMFN046B15+ TGTACGG
JMFF050H06+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTAAGCGGT
rJMFF050H06- TGTACGGTCTCTCTCTAGAATTGGCTGTTACCTAGCGACTGCTAAGCGGT
JMFN038M02+ TGTACGGTCTCTCTCTAGAATTGGCTGTTC
JMFN029N02+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCG
JMFN015M21- TGTACGGTCTCTCTCTAGAATTGGCTGTTC
JMFF002E02+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAA
rJMFF027I18- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAA
JMFF027I18+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAA
rJMFF041E23- TGTACGGTCTCTCTCTAGAATTGGCTGTTCCCTAGCGACTGCTTAGCGGTCAACAAT
JMFF041E23+ TGTACGGTCTCTCTATAGAATTGGCTGTTCCCTAGCGACTGCTTAGCGGTCAACAATC
rJMFF019O11- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAGCAAT
JMFF019O11+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAGCAAT
rJMFF019F09- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAAT
JMFF019F09+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAAT
rJMSF048G16- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATAC
JMSF051A22+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATC
rJMSF051A22- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATC
rJMSF030E22- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATC
JMSF030E22+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATC
rJMFF028A24- TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATAC
JMFF028A24+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATAC
JMSF048G16+ TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATACC
                      ____________________________________________________________
consensus TGTACGGTCTCTCTCTAGAATTGGCTGTTCTCTAGCGACTGCTTAGCGGTCAACAATCCC