Previous Contig 007838:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023P07Sequence479007838 (7)gb:AP004399_18412039e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045656013769 (5)gb:AP004399_18412032e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMFS063E09Sequence627007838 (7)gb:AP004399_18412035e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMFS101E03Sequence641007838 (7)gb:AP004399_18412039e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMSF021O21Sequence668007838 (7)gb:AP004399_18412033e-73Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045721013769 (5)gb:AP004399_18412034e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMSF036B04Sequence651007838 (7)gb:AP004399_18412034e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045680013769 (5)gb:AP004399_18412031e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMSF036E12Sequence651007838 (7)gb:AP004399_18412034e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045752013769 (5)gb:AP004399_18412036e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045
JMSF048G04Sequence685007838 (7)gb:AP004399_18412032e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045714013769 (5)gb:AP004399_18412032e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS063E09+ CTGATGCCGGCAACAAAACCCTTGAAATACTCTCCTGTGAAAGCCCGTCTCTTG
                      ____________________________________________________________
consensus CTGATGCCGGCAACAAAACCCTTGAAATACTCTCCTGTGAAAGCCCGTCTCTTG
 
. : . : . : . : . : . :
JMFS063E09+ CACCTGCAATAACCCCAGTAGTTGGTTTTGGTTTCTTGATAAAGAAACCCATCTGCTCCA
                      ____________________________________________________________
consensus CACCTGCAATAACCCCAGTAGTTGGTTTTGGTTTCTTGATAAAGAAACCCATCTGCTCCA
 
. : . : . : . : . : . :
JMFS063E09+ AAATTTGGTCTTTAGTGATCTCCTTCGACCCCTTGAACACATAAACCTTTGGAATCTGCC
JMFS101E03+ AGTGATCTCCTTCGACCCCTTGAACACATAAACCTTTGGAATCTGCC
JMSF021O21+ AACACATAAACCTTTGGAATCTGCC
JMSF036E12+ TGCC
JMSF036B04+ TGCC
JMSF048G04+ AACACATAAACCTTTGGAATCTGCC
                      ____________________________________________________________
consensus AAATTTGGTCTTTAGTGATCTCCTTCGACCCCTTGAACACATAAACCTTTGGAATCTGCC
 
. : . : . : . : . : . :
JMFS063E09+ CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
JMFS101E03+ CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
JMSF021O21+ CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
JMSF036E12+ CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
JMSF036B04+ CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
JMSF048G04+ CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
                      ____________________________________________________________
consensus CAAAGCCCAGCTCATGAACTTGAACATATGAACCAAAAGTTATTAACCCAATCAAGCAAT
 
. : . : . : . : . : . :
JMFS063E09+ TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
JMFS101E03+ TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
JMSF021O21+ TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
JMSF036E12+ TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
JMSF036B04+ TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
JMSF048G04+ TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
                      ____________________________________________________________
consensus TCTCAGGCAATGTGCCTAACACCTGTAAGAGGGAGGATTTGAGGAAGCCAATCTCCTCCT
 
. : . : . : . : . : . :
JMFS063E09+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
JMFS101E03+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
JMFF023P07+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
JMSF021O21+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
JMSF036E12+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
JMSF036B04+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
JMSF048G04+ CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
                      ____________________________________________________________
consensus CAATGAGGCAGGTGTCGATGACGAAGAGGAAGACAGGGCTAGTGACGGCGGCTCTCTCGG
 
. : . : . : . : . : . :
JMFS063E09+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
JMFS101E03+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
JMFF023P07+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
JMSF021O21+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
JMSF036E12+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
JMSF036B04+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
JMSF048G04+ GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
                      ____________________________________________________________
consensus GGGCGCTCTCGTATTCAATTGTGGTGTACTGAGGGAAGAGCTCGGCGGGCATGTTAGTGT
 
. : . : . : . : . : . :
JMFS063E09+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
JMFS101E03+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
JMFF023P07+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
JMSF021O21+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
JMSF036E12+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
JMSF036B04+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
JMSF048G04+ CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
                      ____________________________________________________________
consensus CGGAGATGGACTGGTAATTGGCGGGGAAATGGTTGCGCTGCAAGCAGAAGCAGCAGATCC
 
. : . : . : . : . : . :
JMFS063E09+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
JMFS101E03+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
JMFF023P07+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
JMSF021O21+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
JMSF036E12+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
JMSF036B04+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
JMSF048G04+ ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
                      ____________________________________________________________
consensus ACATCTTGGTGGTGGAGAAGTCGACGACGGAGAAGGGATTGAGCACCGATCGGCAGTTCC
 
. : . : . : . : . : . :
JMFS063E09+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
JMFS101E03+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
JMFF023P07+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
JMSF021O21+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
JMSF036E12+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
JMSF036B04+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
JMSF048G04+ TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
                      ____________________________________________________________
consensus TGCAGCGGAGCGGAGCATAGGGGAGGACCGGGTGGTCCGGGAAGGGTTTTAAGGGAGTGT
 
. : . : . : . : . : . :
JMFS063E09+ AGATGGCGGAGAACGGAATCACGCATTGCGCCG
JMFS101E03+ AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
JMFF023P07+ AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
JMSF021O21+ AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
JMSF036E12+ AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
JMSF036B04+ AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
JMSF048G04+ AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
                      ____________________________________________________________
consensus AGATGGCGGAGACCGGAATCACGCATTGCGCCGCCTCGGATTTCGTCCCCGGCAAGACGT
 
. : . : . : . : . : . :
JMFS101E03+ TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
JMFF023P07+ TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
JMSF021O21+ TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
JMSF036E12+ TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
JMSF036B04+ TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
JMSF048G04+ TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
                      ____________________________________________________________
consensus TCCACGGCATCCGCACCGCATCTTGAGCTTCCAGCTCCAGAAACTCCGTCATGCTTAACG
 
. : . : . : . : . : . :
JMFS101E03+ GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGC
JMFF023P07+ GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGCGTTAC
JMSF021O21+ GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGCGTTACA
JMSF036E12+ GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGCGTTACA
JMSF036B04+ GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGCGTTACA
JMSF048G04+ GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGCGTTACA
                      ____________________________________________________________
consensus GCGAACGGCTGTGATCGTCGCAAATCGGGCCTCCGATGGTGGCGCTCGCACGGCGTTACA
 
. : . : . : . : . : . :
JMSF021O21+ GCTCACAACAGACTAAAGTTAAAAGAGTTGTGAGTGCTA
JMSF036E12+ GCTCACAACAGACTAAAGTTAAAAGAGTTGTGAGTGCTA
JMSF036B04+ GCTCACAACAGACTAAAGTTAAAAGAGTTGTGAGTGCTA
JMSF048G04+ GCTCACAACAGACTAAAGTTAAAAGAGTTGTGAGTGCTACGATGATGGCCGATGCCCCTC
                      ____________________________________________________________
consensus GCTCACAACAGACTAAAGTTAAAAGAGTTGTGAGTGCTACGATGATGGCCGATGCCCCTC