Previous Contig 007837:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014N14Sequence590007837 (19)gb:OSJN00104_16949852e-37Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque686007837 (19)gb:OSJN00104_16949852e-41Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFF023L22Sequence476007837 (19)gb:OSJN00104_16949852e-35Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque693007837 (19)gb:OSJN00104_16949853e-44Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFF024L09Sequence434007837 (19)gb:OSJN00104_16949856e-25Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFF042L14Sequence583007837 (19)gb:OSJN00104_16949856e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque641007837 (19)gb:OSJN00104_16949851e-43Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFF048P01Sequence449007837 (19)gb:OSJN00104_16949852e-35Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque368007837 (19)gb:AY088360_15733801e-12Arabidopsis thaliana clone 6145 mRNA, complete sequence.
JMFF050F01Sequence271007837 (19)274007837 (19)
JMFN029I02Sequence654007837 (19)gb:OSJN00104_16949857e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFN031A23Sequence626007837 (19)gb:OSJN00104_16949857e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFS026G08Sequence615007837 (19)gb:OSJN00104_16949856e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMFS118A08Sequence305007837 (19)gb:AY088360_15733802e-08Arabidopsis thaliana clone 6145 mRNA, complete sequence.
JMSF048F23Sequence643007837 (19)gb:OSJN00104_16949857e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque671007837 (19)gb:OSJN00104_16949858e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque
JMSF049A10Sequence683007837 (19)gb:OSJN00104_16949858e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque672007837 (19)gb:OSJN00104_16949858e-45Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042L14- ACCCTGGAGAGTTTTTTTTTTT
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF048P01- AATAAGTAGATCATTTACTGCTGGTATTTCAGACATACAATATCATGACTCACA
rJMFF050F01- AATAAGTAGATCATTTACTGCTGGTATTTCAGACATACAATATCATGACTCACA
JMFF050F01+ AATAAGTAGATCATTTACTGCTGGTATTTCAGACATACAATATCATGACTCACA
rJMFF042L14- TTTTGCAATAAGTAGATCATTTACTGCTGGTATTTCAGACATACAATATCATGACTCACA
rJMFF014N14- TTTACTGCTGGTATTTCAGACATACAATATCATGACTCACA
JMFS118A08+ CAGACATACAATATCATGACTCACA
JMFN029I02+ GTATTTCAGACATACAATATCATGACTCACA
rJMFF023L22- CTGCTGGTATTTCAGACATACAATATCATGACTCACA
rJMSF048F23- ATATCATGACTCACA
rJMSF049A10- GACTCACA
JMSF049A10+ TTCAGACATACAATATCATGACTCACA
                      ____________________________________________________________
consensus TTTTGCAATAAGTAGATCATTTACTGCTGGTATTTCAGACATACAATATCATGACTCACA
 
. : . : . : . : . : . :
rJMFF048P01- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
rJMFF050F01- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMFF050F01+ TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
rJMFF042L14- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
rJMFF014N14- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMFS118A08+ TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMFN029I02+ TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
rJMFF023L22- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMFN031A23+ AATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMFS026G08+ AACTCAAATGAGACCATAACTGGCGTTATTCATAACCATTCATCGAAATAAACA
JMFF014N14+ AAACA
rJMSF048F23- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
rJMSF049A10- TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMSF049A10+ TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
JMSF048F23+ ATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
                      ____________________________________________________________
consensus TTTCTGAACTCAAATGAGACCATAACTGGCCTTATTCATAACCATTCATCGAAATAAACA
 
. : . : . : . : . : . :
rJMFF048P01- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
rJMFF050F01- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFF050F01+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
rJMFF042L14- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
rJMFF014N14- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFS118A08+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFN029I02+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
rJMFF024L09- CAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAANAACAGTTGAAAG
rJMFF023L22- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFN031A23+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFS026G08+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFF042L14+ AGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMFF014N14+ CACAACATTTNTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
rJMSF048F23- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
rJMSF049A10- CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMSF049A10+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
JMSF048F23+ CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
                      ____________________________________________________________
consensus CACAACATTTCTAGTGACCCAGACAGACCTGAAGGTGATTCCATCAAGAACAGTTGAAAG
 
. : . : . : . : . : . :
rJMFF048P01- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
rJMFF050F01- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFF050F01+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
rJMFF042L14- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
rJMFF014N14- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFS118A08+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFN029I02+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
rJMFF024L09- TAAAGCATTTTATGCCTTGAGAAAGGCTTCAAGATCCTTGAATGTCTTAACGGNNGCATC
rJMFF023L22- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFN031A23+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFS026G08+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFF048P01+ CATC
JMFF042L14+ TAGAGCATTTTATGCCTGGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMFF014N14+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
rJMSF048F23- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
rJMSF049A10- TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMSF049A10+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
JMSF048F23+ TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
                      ____________________________________________________________
consensus TAGAGCATTTTATGCCTTGAGAAAGGCTTCGAGATCCTTGAATGTCTTAACGGCGGCATC
 
. : . : . : . : . : . :
rJMFF048P01- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
rJMFF050F01- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGC
JMFF050F01+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT
rJMFF042L14- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
rJMFF014N14- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMFS118A08+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMFN029I02+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
rJMFF024L09- CTTGATGATGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCTAATTCACACCCCCAC-
rJMFF023L22- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMFN031A23+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMFS026G08+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMFF048P01+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCC-TCTNGAATTCACACCCCCAC-
JMFF042L14+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMFF014N14+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACTAAGCCTTCTCGAATTCACACCCCCACT
JMFF023L22+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCACT
rJMSF048F23- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
rJMSF049A10- CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMSF049A10+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
JMSF048F23+ CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
                      ____________________________________________________________
consensus CTTGATGAGGTGGGGATCAGGAACCTCGGCACT-AGCCTTCTCGAATTCACACCCCCAC-
 
. : . : . : . : . : . :
rJMFF048P01- TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
rJMFF042L14- TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
rJMFF014N14- TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFS118A08+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAA
JMFN029I02+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
rJMFF024L09- TTCACCAATGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAANCCTTGAAATCCTTGTA
rJMFF023L22- TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFN031A23+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFS026G08+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFF048P01+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFF042L14+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFF014N14+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMFF023L22+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
rJMSF048F23- TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
rJMSF049A10- TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMSF049A10+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
JMSF048F23+ TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
                      ____________________________________________________________
consensus TTCACC-AGGCTCCCGTCTCCCTTTGGAGTCACAGACAGGTAAGCCTTGAAATCCTTGTA
 
. : . : . : . : . : . :
rJMFF048P01- GTATTTCAGGATGTC
rJMFF042L14- GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
rJMFF014N14- GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMFN029I02+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
rJMFF024L09- GTATTTCANGATGTCACCCTCAATCACATGGNAGCTCACTGTCTTCTTCTCATTATCTAC
rJMFF023L22- GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATTATCTAC
JMFN031A23+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMFS026G08+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMFF048P01+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMFF042L14+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMFF014N14+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMFF023L22+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATTATCTAC
rJMSF048F23- GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
rJMSF049A10- GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMSF049A10+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
JMSF048F23+ GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
                      ____________________________________________________________
consensus GTATTTCAGGATGTCACCCTCAATCACATGGTAGCTCACTGTCTTCTTCTCATCATCTAC
 
. : . : . : . : . : . :
rJMFF042L14- TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
rJMFF014N14- TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFN029I02+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
rJMFF024L09- TGTGNCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACNTATTTGATNAA
rJMFF023L22- TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFN031A23+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFS026G08+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFF048P01+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFF042L14+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFF014N14+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMFF023L22+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
rJMSF048F23- TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
rJMSF049A10- TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMSF049A10+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
JMSF048F23+ TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
                      ____________________________________________________________
consensus TGTGTCTATCTTCTCCTTTGAGAATGTGACCAGTGGAGCTCCATCAACATATTTGATCAA
 
. : . : . : . : . : . :
rJMFF042L14- GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
rJMFF014N14- GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFN029I02+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
rJMFF024L09- GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAANAACCTCAATACTCTTGTANACATC
rJMFF023L22- GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFN031A23+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFS026G08+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFF048P01+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFF042L14+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFF014N14+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMFF023L22+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
rJMSF048F23- GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
rJMSF049A10- GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMSF049A10+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
JMSF048F23+ GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
                      ____________________________________________________________
consensus GCGGATTGAGCCAACGGCCTTTCCATCGCCTTCAAGAACCTCAATACTCTTGTAGACATC
 
. : . : . : . : . : . :
rJMFF042L14- AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
rJMFF014N14- AGGGAAAGCCTTGGGGAAGAGGGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFN029I02+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
rJMFF024L09- ACGGAAAGCCTTGGGGAA
rJMFF023L22- AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFN031A23+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFS026G08+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFF048P01+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFF042L14+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFF014N14+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMFF023L22+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
rJMSF048F23- AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
rJMSF049A10- AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMSF049A10+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
JMSF048F23+ AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
                      ____________________________________________________________
consensus AGGGAAAGCCTTGGGGAAGA-GGGTGGTGGAGTCCCTGATGCTATTCCAGAACTTGTCAG
 
. : . : . : . : . : . :
rJMFF042L14- CACCAATGCTAACCTCCAAGTCC
rJMFF014N14- CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFN029I02+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
rJMFF023L22- CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFN031A23+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFS026G08+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFF048P01+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFF042L14+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFF014N14+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMFF023L22+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
rJMSF048F23- CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
rJMSF049A10- CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMSF049A10+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
JMSF048F23+ CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
                      ____________________________________________________________
consensus CACCAATGCTAACCTCCAAGTCCACTTCAATCTTTCCTTGAGCAGCCATAGCTAAATACC
 
. : . : . : . : . : . :
rJMFF014N14- TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAA
JMFN029I02+ TTGAAACCAAGCTAAGAATGGGT
rJMFF023L22- TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAA
JMFN031A23+ TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAA
JMFS026G08+ TTGAAACCAAGCTAAGAATGGGTTA
JMFF048P01+ TTGAAACCAAGCTAAGAATGGGTTAGAAAA
JMFF042L14+ TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGT
JMFF014N14+ TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGT
JMFF023L22+ TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGT
rJMSF048F23- TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGTC
rJMSF049A10- TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGTC
JMSF049A10+ TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGTC
JMSF048F23+ TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGTC
                      ____________________________________________________________
consensus TTGAAACCAAGCTAAGAATGGGTTAGAAAAGAGATAAGGAAATAGGTAGAGAAGTGTGTC