Previous Contig 007834:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027A21Sequence593007834 (4)pir|G86171|G861714e-07hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889425 Arabid749009481 (3)gb:AY045576_15611686e-13Arabidopsis thaliana SET domain protein SUVR2 mRNA, complete cds.
JMFN033C20Sequence605007834 (4)pir|G86171|G861714e-07hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889425 Arabid
JMSF030M08Sequence655007834 (4)pir|G86171|G861715e-07hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889425 Arabid735009481 (3)gb:AY045576_15611686e-13Arabidopsis thaliana SET domain protein SUVR2 mRNA, complete cds.
JMSF048F01Sequence645007834 (4)pir|G86171|G861715e-07hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889425 Arabid755009481 (3)gb:AY045576_15611686e-13Arabidopsis thaliana SET domain protein SUVR2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030M08+ AAACCAGTTCCTGCACTACAAGAACTNGGCTGACTTTTGTCTGC
                      ____________________________________________________________
consensus AAACCAGTTCCTGCACTACAAGAACTNGGCTGACTTTTGTCTGC
 
. : . : . : . : . : . :
JMFF027A21+ GAGCATTGGGAGAAACAGGCTGTTTTCCTTTGTTCTGAGCAATATATTG
JMSF030M08+ ACCAGAAAGCTGAGCATTGGGAGAAACAGGCTGTTTTCCTTTGTTCTGAGCAATATATTG
JMFN033C20+ CTGAGCATTGGGAGAAACAGGCTGTTNTCC-TTGTTCTGAGCAATATATTG
JMSF048F01+ GAGCATTGGGAGAAACAGGCTGTTTTCCTTTGTTCTGAGCAATATATTG
                      ____________________________________________________________
consensus ACCAGAAAGCTGAGCATTGGGAGAAACAGGCTGTTTTCCTTTGTTCTGAGCAATATATTG
 
. : . : . : . : . : . :
JMFF027A21+ ACATGATGCAGGCTGTGGTTCAGAATCCATATGGCCATTAGAGGAGTTGTGCAGTCCAAG
JMSF030M08+ ACATGATGCAGGCTGTGGTTCAGAATCCATATGGCCATTAGAGGAGTTGTGCAGTCCAAG
JMFN033C20+ ACATGATGCAGGCTGTGGTTCAGAATCCATATGGCCATTAGAGGAGTTGTGCAGTCCAAG
JMSF048F01+ ACATGATGCAGGCTGTGGTTCAGAATCCATATGGCCATTAGAGGAGTTGTGCAGTCCAAG
                      ____________________________________________________________
consensus ACATGATGCAGGCTGTGGTTCAGAATCCATATGGCCATTAGAGGAGTTGTGCAGTCCAAG
 
. : . : . : . : . : . :
JMFF027A21+ AAGTTCAGCCCCCTCAACATCATGCCTCACCTGTGAAGTTCCACCCAGGCTGGATGGTGA
JMSF030M08+ AAGTTCAGCCCCCTCAACATCATGCCTCACCTGTGAAGTTCCACCCAGGCTGGATGGTGA
JMFN033C20+ AAGTTCAGCCCCCTCAACATCATGCCTCACCTGTGAAGTTCCACCCAGGCTGGATGGTGA
JMSF048F01+ AAGTTCAGCCCCCTCAACATCATGCCTCACCTGTGAAGTTCCACCCAGGCTGGATGGTGA
                      ____________________________________________________________
consensus AAGTTCAGCCCCCTCAACATCATGCCTCACCTGTGAAGTTCCACCCAGGCTGGATGGTGA
 
. : . : . : . : . : . :
JMFF027A21+ TGATAGACCAGCTTCAGCTTCCTGTCTCAAACGCGATCTTTTTAAGGGCCTCATAGGCTC
JMSF030M08+ TGATAGACCAGCTTCAGCTTCCTGTCTCAAACGCGATCTTTTTAAGGGCCTCATAGGCTC
JMFN033C20+ TGATAGACCAGCTTCAGCTTCCTGTCTCAAACGCGATCTTTTTAAGGGCCTCATAGGCTC
JMSF048F01+ TGATAGACCAGCTTCAGCTTCCTGTCTCAAACGCGATCTTTTTAAGGGCCTCATAGGCTC
                      ____________________________________________________________
consensus TGATAGACCAGCTTCAGCTTCCTGTCTCAAACGCGATCTTTTTAAGGGCCTCATAGGCTC
 
. : . : . : . : . : . :
JMFF027A21+ TTCATCCACAACCTCTTCTTCCTCCAAATTATCCTCTTCAGCATTCTTTGATGATTTCCG
JMSF030M08+ TTCATCCACAACCTCTTCTTCCTCCAAATTATCCTCTTCAGCATTCTTTGATGATTTCCG
JMFN033C20+ TTCATCCACAACCTCTTCTTCCTCCAAATTATCCTCTTCAGCATTCTTTGATGATTTCCG
JMSF048F01+ TTCATCCACAACCTCTTCTTCCTCCAAATTATCCTCTTCAGCATTCTTTGATGATTTCCG
                      ____________________________________________________________
consensus TTCATCCACAACCTCTTCTTCCTCCAAATTATCCTCTTCAGCATTCTTTGATGATTTCCG
 
. : . : . : . : . : . :
JMFF027A21+ ACGTTTTGCTTCCTCAGCTTCCTCATTGTCAAAAATTGCATCTATAAGGGGTCTATAGTT
JMSF030M08+ ACGTTTTGCTTCCTCAGCTTCCTCATTGTCAAAAATTGCATCTATAAGGGGTCTATAGTT
JMFN033C20+ ACGTTTTGCTTCCTCAGCTTCCTCATTGTCAAAAATTGCATCTATAAGGGGTCTATAGTT
JMSF048F01+ ACGTTTTGCTTCCTCAGCTTCCTCATTGTCAAAAATTGCATCTATAAGGGGTCTATAGTT
                      ____________________________________________________________
consensus ACGTTTTGCTTCCTCAGCTTCCTCATTGTCAAAAATTGCATCTATAAGGGGTCTATAGTT
 
. : . : . : . : . : . :
JMFF027A21+ CTCCTCTTCAATGAGGTCCCAGTTTTTGTTATACAACTTCAAAAGACGTTTCAATACGGG
JMSF030M08+ CTCCTCTTCAATGAGGTCCCAGTTTTTGTTATACAACTTCAAAAGACGTTTCAATACGGG
JMFN033C20+ CTCCTCTTCAATGAGGTCCCAGTTTTTGTTATACAACTTCAAAAGACGTTTCAATACGGG
JMSF048F01+ CTCCTCTTCAATGAGGTCCCAGTTTTTGTTATACAACTTCAAAAGACGTTTCAATACGGG
                      ____________________________________________________________
consensus CTCCTCTTCAATGAGGTCCCAGTTTTTGTTATACAACTTCAAAAGACGTTTCAATACGGG
 
. : . : . : . : . : . :
JMFF027A21+ CTTCACCTTGTCTTCAGAGATCCCAAGCACTTTCATTGCACGAAAGGCACTCACAATCCT
JMSF030M08+ CTTCACCTTGTCTTCAGAGATCCCAAGCACTTTCATTGCACGAAAGGCACTCACAATCCT
JMFN033C20+ CTTCACCTTGTCTTCAGAGATCCCAAGCACTTTCATTGCACGAAAGGCACTCACAATCCT
JMSF048F01+ CTTCACCTTGTCTTCAGAGATCCCAAGCACTTTCATTGCACGAAAGGCACTCACAATCCT
                      ____________________________________________________________
consensus CTTCACCTTGTCTTCAGAGATCCCAAGCACTTTCATTGCACGAAAGGCACTCACAATCCT
 
. : . : . : . : . : . :
JMFF027A21+ AGGATGAGCCATTCCTCACCCTAGCAAGCTCTTAGAGAAGCCTTGGATTCTCAATCAAGG
JMSF030M08+ AGGATGAGCCATTCCTCACCCTAGCAAGCTCTTAGAGAAGCCTTGGATTCTCAATCAAGG
JMFN033C20+ AGGATGAGCCATTCCTCACCCTAGCAAGCTCTTAGAGAAGCCTTGGATTCTCAATCAAGG
JMSF048F01+ AGGATGAGCCATTCCTCACCCTAGCAAGCTCTTAGAGAAGCCTTGGATTCTCAATCAAGG
                      ____________________________________________________________
consensus AGGATGAGCCATTCCTCACCCTAGCAAGCTCTTAGAGAAGCCTTGGATTCTCAATCAAGG
 
. : . : . : . : . : . :
JMFF027A21+ GTCAACCTAACAGTGTTCATGGTTGGGGCCGCAGAGAATCTAGGGTATACTGAAGAGGAA
JMSF030M08+ GTCAACCTAACAGTGTTCATGGTTGGGGCCGCAGAGAATCTAGGGTATACTGAAGAGGAA
JMFN033C20+ GTCAAC----CAGTGTTCATGGTTGGGGCCGCAGAGAATCTAGGGTATACTGAAGAGGAA
JMSF048F01+ GTCAAC----CAGTGTTCATGGTTGGGGCCGCAGAGAATCTAGGGTATACTGAAGAGGAA
                      ____________________________________________________________
consensus GTCAACCTAACAGTGTTCATGGTTGGGGCCGCAGAGAATCTAGGGTATACTGAAGAGGAA
 
. : . : . : . : . : . :
JMFF027A21+ CT
JMSF030M08+ CTGCGAAGCT
JMFN033C20+ CTGCGAAGCT
JMSF048F01+ CTGCGAAGCTGAGACCTGAGGGGGGAATCGAAAAAGAGGAGAGGGAAGTTGGAACACGCC
                      ____________________________________________________________
consensus CTGCGAAGCTGAGACCTGAGGGGGGAATCGAAAAAGAGGAGAGGGAAGTTGGAACACGCC