Previous Contig 007833:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028A02Sequence687007833 (2)gb:AE005172_8917192e-68Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC010155_153693746002776 (4)gb:AE005172_8917195e-59Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC010155_153693
JMSF048E14Sequence711007833 (2)gb:AE005172_8917192e-69Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC010155_153693764002776 (4)gb:AE005172_8917196e-63Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC010155_153693

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028A02+ TTCCAAAGTAGTATGCTCTATCATCTACTTGGAGAATTTCAATAGCCAGT
JMSF048E14+ GTTCCAAAGTAGTATGCTCTATCATCTACTTGGAGAATTTCAATAGCCAGT
                      ____________________________________________________________
consensus GTTCCAAAGTAGTATGCTCTATCATCTACTTGGAGAATTTCAATAGCCAGT
 
. : . : . : . : . : . :
JMSF028A02+ ATTGCATGATCTCCATGACCAGTGCTGTGAAAGCATAGCGATGCAGTGCCATCTTCAAGA
JMSF048E14+ ATTGCAGGATCTCCATGACCAGTGCTGTGAAAGCATAGCGATGCAGTGCCATCTTCAAGA
                      ____________________________________________________________
consensus ATTGCATGATCTCCATGACCAGTGCTGTGAAAGCATAGCGATGCAGTGCCATCTTCAAGA
 
. : . : . : . : . : . :
JMSF028A02+ AATACAAGGGCTTCAACAAACACTCCCTCATCATCATGAATGCTCCAACCAGATTGCAGA
JMSF048E14+ AATACAAGGGCTTCAACAAACACTCCCTCATCATCATGAATGCTCCAACCAGATTGCAGA
                      ____________________________________________________________
consensus AATACAAGGGCTTCAACAAACACTCCCTCATCATCATGAATGCTCCAACCAGATTGCAGA
 
. : . : . : . : . : . :
JMSF028A02+ GTATAAATTAAGGTTCCTTCAACAGATACATCAAAAAGTGGTTCATTATCAAAACTAGGA
JMSF048E14+ GTATAAATTAAGGTTCCTTCAACAGATACATCAAAAAGTGGTTCATTATCAAAACTAGGA
                      ____________________________________________________________
consensus GTATAAATTAAGGTTCCTTCAACAGATACATCAAAAAGTGGTTCATTATCAAAACTAGGA
 
. : . : . : . : . : . :
JMSF028A02+ TCTGCCACCAACCCAAAATAAATCCTTACTGAATAGTGGCCATGTGGCACTCTCTTGATA
JMSF048E14+ TCTGCCACCAACCCAAAATAAATCCTTACTGAATAGTGGCCATGTGGCACTCTCTTGATA
                      ____________________________________________________________
consensus TCTGCCACCAACCCAAAATAAATCCTTACTGAATAGTGGCCATGTGGCACTCTCTTGATA
 
. : . : . : . : . : . :
JMSF028A02+ TTGTAGCAATTTTCTGGACCTTCCGATAAAGGGAAGTACCGAAGTGTTTCAAGTGGAGGA
JMSF048E14+ TTGTAGCAATTTTCTGGACCTTCCGATAAAGGGAAGTACCGAAGTGTTTCAAGTGGAGGA
                      ____________________________________________________________
consensus TTGTAGCAATTTTCTGGACCTTCCGATAAAGGGAAGTACCGAAGTGTTTCAAGTGGAGGA
 
. : . : . : . : . : . :
JMSF028A02+ CTGATAAAAGTCGGGCGGGTTCCATTAGTTGGTATCCCTCCTGTATATGCAAAATCTTTA
JMSF048E14+ CTGATAAAAGTCGGGCGGGTTCCATTAGTTGGTATCCCTCCTGTATATGCAAAATCTTTA
                      ____________________________________________________________
consensus CTGATAAAAGTCGGGCGGGTTCCATTAGTTGGTATCCCTCCTGTATATGCAAAATCTTTA
 
. : . : . : . : . : . :
JMSF028A02+ TACCAGAGAGTATTTGTAGGTTTGGTATGAACATTCTGCCTAGCTCCACAACTAATCCGC
JMSF048E14+ TACCAGAGAGTATTTGTAGGTTTGGTATGAACATTCTGCCTAGCTCCACAACTAATCCGC
                      ____________________________________________________________
consensus TACCAGAGAGTATTTGTAGGTTTGGTATGAACATTCTGCCTAGCTCCACAACTAATCCGC
 
. : . : . : . : . : . :
JMSF028A02+ ATAACATAAGGCCCAGGGCTAGAGAAGGAGAGCTTGAAGGCGAAACAGAGAGCGAGGAAG
JMSF048E14+ ATAACATAAGGCCCAGGGCTAGAGAAGGAGAGCTTGAAGGCGAAACAGAGAGCGAGGAAG
                      ____________________________________________________________
consensus ATAACATAAGGCCCAGGGCTAGAGAAGGAGAGCTTGAAGGCGAAACAGAGAGCGAGGAAG
 
. : . : . : . : . : . :
JMSF028A02+ ATGGAGAGGAAACGAAGGCTGTGCATTTTGGACTGGAACTTCTTCATCGGATTCTTTGCT
JMSF048E14+ ATGGAGAGGAAACGAAGGCTGTGCATTTTGGACTGGAACTTCTTCATCGGATTCTTTGCT
                      ____________________________________________________________
consensus ATGGAGAGGAAACGAAGGCTGTGCATTTTGGACTGGAACTTCTTCATCGGATTCTTTGCT
 
. : . : . : . : . : . :
JMSF028A02+ TCAATTTCTCCTCAGTCTTTTTGAATCGTTGAATCCTCCATTTTCCATTTCTTCTGAGAA
JMSF048E14+ TCAATTTCTCCTCAGTCTTTTTGAATCGTTGAATCCTCCATTTTCCATTTCTTCTGAGAA
                      ____________________________________________________________
consensus TCAATTTCTCCTCAGTCTTTTTGAATCGTTGAATCCTCCATTTTCCATTTCTTCTGAGAA
 
. : . : . : . : . : . :
JMSF028A02+ TGTAGAGAGAGATAAAGGTGAAGAGATGGACAAGC
JMSF048E14+ TGTAGAGAGAGATAAAGGTGAAGAGATGGACAAGCCGGACGTGCTGTGCAGCTAATTCCC
                      ____________________________________________________________
consensus TGTAGAGAGAGATAAAGGTGAAGAGATGGACAAGCCGGACGTGCTGTGCAGCTAATTCCC